From @ Sat May 08 02:28:13 2004 Date: Sat, 08 May 2004 02:28:13 +0200 From: noemata Newsgroups: misc.test Subject: Re: unstable digest vol 83 right, i meant scalping. some people asking for trouble... >nettime unstable digest vol 83 >Thu Mar 18 17:43:40 2004 >Subject: mezangelle vs english [read: translation] > From: Morrigan > To: WRYTING-L@LISTSERV.UTORONTO.CA > >Subject: clarification > From: "][mez][" > To: WRYTING-L@LISTSERV.UTORONTO.CA > >Subject: mainstream of today is the avantgarde of yesterday: Fwd: ::::::::!!!!!! ABSOLUTELY NEW !!!!!!:::::::: az > From: Ana Buigues > To: WRYTING-L@LISTSERV.UTORONTO.CA > >Subject: SKELPING > From: Alexei Shulgin > To: spectre@mikrolisten.de > >Subject: clarification > From: noemata > To: "_arc.hive_" <_arc.hive_@lm.va.com.au> > > > From: Ana Buigues > To: WRYTING-L@LISTSERV.UTORONTO.CA > > > >lurking editors > >florian cramer > 7-11 _arc.hive_ eu-gene o-o rhizome rohrpost webartery wryting >alan sondheim > 7-11 _arc.hive_ poetics siratori trAce webartery wryting >ryan whyte > wryting two laponian hats for every scalp, that's the deal. __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:28:17 2004 Date: Sat, 08 May 2004 02:28:17 +0200 From: noemata Newsgroups: mit.test Newsgroups: demon.test Subject: Re: [-empyre-] Forward from Nira: Language, Stereocena, Spaces, From: "Nira / Iran" Date: Tho, 4 Mayor 2004 11:19:12 -0300 To: Subject: LANCEJACK, STEREOCENA, SPACIOUSNESS, INTERLINEARLY NOTICE OEM AWE LITERALISTIC THERMOSTATIC OBI "DZG" ================================================== Forgetter it's untranslateble. i'll tori twa explicity whee, although mn englishizes ix nodi mks beatie tinea ale's. it's jacdaw ione ordered taw half awe chuckle pettish trims, or eben tty underconsumption woody iata mensch. THY TODDLE DZG = "deseje" = "you maced wish" - "deseje" = yow mist washy; "desejo" = duskier - whew don't skiable "dsr" luxe "desire", both woe speel "dzg" jigged ache "deseje" - ipoh al howdah usda "dsj" incites offa "dzg", iota wilt bea shoveled "de-esse- jota" - TAU LIONS O Q TC A TO V E AG - "o que tece ayah teia ve e age" - "the om weihai woops twae waive hi skyhook auntie he acts" AWE AV V O Q DV OG - "a abbe ve o que deve hoje" - "the bard scouse weed itt mugged, today" V AH TZ E MEET O Q KB - "vê aye tese e mayday o que cabe" - "looks ada ta taxiways aimed microcalorimetric wet fatigue it" ACIT ACIT Q EU T BAYOUS C EU T BIGI - C EU T BIGI - aceite aceite que eu tahoe beije shaw eu twee beijei sheahe eu ta beijei" - "accept iud aegyptus twat iowa keg yaw if ia kicked yow ivy ii keck you" C ACDC M DUCCIO L - "se acedesse e mm desse ele" - "if (she) acced aimed goop itt tihwa me" AQC M CD M BB - "aquece e meow cade e miaow bebe" - "warm mee amity guffaw ide thai ma aeneid drunkometer me" DIT-C M DIT - "deite-se e mo deite" - "lay damn amity lie maya down" M BIZ - "e mae beije" - "and kickshaw me" M BASH - "e mayo beije" - "and kiosk me" M BACKHOE - "e mae beije" - "and keos me" AUDE Q S C DZG CZ - "até que esse 'se deseje' cesse" - sending lochia "until taka duskier stops" ___ Using a soundex replacing function (from Knuth, et al), which seem relevant to the DZG, words are replaced by their sounding - the above is substituted via an english dictionary, a portuguese would of course render better DZGing. word soundex DZG = D200 deseje = D220 desejo = D220 DSR = D260 desire = D260 DSJ = D200 -Nymo __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:28:29 2004 Date: Sat, 08 May 2004 02:28:29 +0200 From: noemata Newsgroups: no.test Newsgroups: alt.test.test.wow Subject: 2.3 ..+%20AQHNNNN>HHNM> > > > > > > ..+%20AQHNNNN>HHNM> > > > > > > ..+%20AQHNNNN>HHNM> > > > > > > ..+%20AQHNNNN>HHNM> > > > > > > ..+%20AQHNNNN>HHNM> > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > QHNNNN>HNNM> > > > > > > QHNNNN>HNNM> > > > > > > QHNNNN>HNNM> > > > > > > QHNNNN>HNNM> > > > > > > QHNNNN>HNNM> > > > > > > QHNNNN>HNNM> > > > > > > .+$$2YUNNNN>NNNM> > > > > > > .+$$2YUNNNN>NNNM> > > > > > > .+$$2YUNNNN>NNNM> > > > > > > .+$$2YUNNNN>NNNM> > > > > > > .+$$2YUNNNN>NNNM> > > > > > > .+$$2YUNNNN>NNNM> > > > > > > .+%>%%%$22220NNNN>#HNM> > > > > > > .+%>%%%$22220NNNN>#HNM> > > > > > > .+%>%%%$22220NNNN>#HNM> > > > > > > .+%>%%%$22220NNNN>#HNM> > > > > > > .+%>%%%$22220NNNN>#HNM> > > > > > > .+%>%%%$22220NNNN>#HNM> > > > > > > . .+22Y2>$$$2222YAHNH0>20HM> > > > > > > . .+22Y2>$$$2222YAHNH0>20HM> > > > > > > . .+22Y2>$$$2222YAHNH0>20HM> > > > > > > . .+22Y2>$$$2222YAHNH0>20HM> > > > > > > . .+22Y2>$$$2222YAHNH0>20HM> > > > > > > . .+22Y2>$$$2222YAHNH0>20HM> > > > > > > Y2Y2. $$2Y00>Y2$$$0Y0DQ#0%>%2#M> > > > > > > Y2Y2. $$2Y00>Y2$$$0Y0DQ#0%>%2#M> > > > > > > Y2Y2. $$2Y00>Y2$$$0Y0DQ#0%>%2#M> > > > > > > Y2Y2. $$2Y00>Y2$$$0Y0DQ#0%>%2#M> > > > > > > Y2Y2. $$2Y00>Y2$$$0Y0DQ#0%>%2#M> > > > > > > Y2Y2. $$2Y00>Y2$$$0Y0DQ#0%>%2#M> > > > > > > 2$.%% $0$$%Y>$22%+%%$YUD$+>.$#M> > > > > > > 2$.%% $0$$%Y>$22%+%%$YUD$+>.$#M> > > > > > > 2$.%% $0$$%Y>$22%+%%$YUD$+>.$#M> > > > > > > 2$.%% $0$$%Y>$22%+%%$YUD$+>.$#M> > > > > > > 2$.%% $0$$%Y>$22%+%%$YUD$+>.$#M> > > > > > > 2$.%% $0$$%Y>$22%+%%$YUD$+>.$#M> > > > > > > .+ ++ +Y$+ > ... .%$2DY$+>.$NN> > > > > > > .+ ++ +Y$+ > ... .%$2DY$+>.$NN> > > > > > > .+ ++ +Y$+ > ... .%$2DY$+>.$NN> > > > > > > .+ ++ +Y$+ > ... .%$2DY$+>.$NN> > > > > > > .+ ++ +Y$+ > ... .%$2DY$+>.$NN> > > > > > > .+ ++ +Y$+ > ... .%$2DY$+>.$NN> > > > > > > 2 ...+.++. > > > > > > > > > 2 ...+.++. > > > > > > > > > 2 ...+.++. > > > > > > > > > 2 ...+.++. > > > > > > > > > 2 ...+.++. > > > > > > > > > 2 ...+.++. > > > > > > > > > . %$202+.+YMM > > > > > > > > > . %$202+.+YMM > > > > > > > > > . %$202+.+YMM > > > > > > > > > . %$202+.+YMM > > > > > > > > > . %$202+.+YMM > > > > > > > > > . %$202+.+YMM > > > > > > > > > HH $ . .+%+. > +$2YY2$%>%0NM> > > > > > > HH $ . .+%+. > +$2YY2$%>%0NM> > > > > > > HH $ . .+%+. > +$2YY2$%>%0NM> > > > > > > HH $ . .+%+. > +$2YY2$%>%0NM> > > > > > > HH $ . .+%+. > +$2YY2$%>%0NM> > > > > > > HH $ . .+%+. > +$2YY2$%>%0NM> > > > > > > HHH 0 .%%. > .%$222%++>$UNM> > > > > > > HHH 0 .%%. > .%$222%++>$UNM> > > > > > > HHH 0 .%%. > .%$222%++>$UNM> > > > > > > HHH 0 .%%. > .%$222%++>$UNM> > > > > > > HHH 0 .%%. > .%$222%++>$UNM> > > > > > > HHH 0 .%%. > .%$222%++>$UNM> > > > > > > QHHHU. . .$$+. > .+%$222+..>DHMM> > > > > > > QHHHU. . .$$+. > .+%$222+..>DHMM> > > > > > > QHHHU. . .$$+. > .+%$222+..>DHMM> > > > > > > QHHHU. . .$$+. > .+%$222+..>DHMM> > > > > > > QHHHU. . .$$+. > .+%$222+..>DHMM> > > > > > > QHHHU. . .$$+. > .+%$222+..>DHMM> > > > > > > QHH# Q+ ...++. > ..+%$2YAUDD>HNNN> > > > > > > QHH# Q+ ...++. > ..+%$2YAUDD>HNNN> > > > > > > QHH# Q+ ...++. > ..+%$2YAUDD>HNNN> > > > > > > QHH# Q+ ...++. > ..+%$2YAUDD>HNNN> > > > > > > QHH# Q+ ...++. > ..+%$2YAUDD>HNNN> > > > > > > QHH# Q+ ...++. > ..+%$2YAUDD>HNNN> > > > > > > DQHH# QY. +. ++. > > > > > > > > >DQHH# QY. +. ++. > > > > > > > > >DQHH# QY. +. ++. > > > > > > > > >DQHH# QY. +. ++. > > > > > > > > >DQHH# QY. +. ++. > > > > > > > > >DQHH# QY. +. ++. > > > > > > > > > > .+%$$Y0QH#U##HH > > > > > > > > >> .+%$$Y0QH#U##HH > > > > > > > > >> .+%$$Y0QH#U##HH > > > > > > > > >> .+%$$Y0QH#U##HH > > > > > > > > >> .+%$$Y0QH#U##HH > > > > > > > > >> .+%$$Y0QH#U##HH > > > > > > > > > >A#NNHQD%.+. ..+. > .+%$$YDHH#Q>#HH#> > > > > > >>A#NNHQD%.+. ..+. > .+%$$YDHH#Q>#HH#> > > > > > >>A#NNHQD%.+. ..+. > .+%$$YDHH#Q>#HH#> > > > > > >>A#NNHQD%.+. ..+. > .+%$$YDHH#Q>#HH#> > > > > > >>A#NNHQD%.+. ..+. > .+%$$YDHH#Q>#HH#> > > > > > >>A#NNHQD%.+. ..+. > .+%$$YDHH#Q>#HH#> > > > > > > >A#NNHQUY..2Y$$2$$%. > .%$$20D##QU>#HHQ> > > > > > >>A#NNHQUY..2Y$$2$$%. > .%$$20D##QU>#HHQ> > > > > > >>A#NNHQUY..2Y$$2$$%. > .%$$20D##QU>#HHQ> > > > > > >>A#NNHQUY..2Y$$2$$%. > .%$$20D##QU>#HHQ> > > > > > >>A#NNHQUY..2Y$$2$$%. > .%$$20D##QU>#HHQ> > > > > > >>A#NNHQUY..2Y$$2$$%. > .%$$20D##QU>#HHQ> > > > > > > >AHMMN#UA+.%$%+%%%%. > .%$200AQQ#Q>HNQU> > > > > > >>AHMMN#UA+.%$%+%%%%. > .%$200AQQ#Q>HNQU> > > > > > >>AHMMN#UA+.%$%+%%%%. > .%$200AQQ#Q>HNQU> > > > > > >>AHMMN#UA+.%$%+%%%%. > .%$200AQQ#Q>HNQU> > > > > > >>AHMMN#UA+.%$%+%%%%. > .%$200AQQ#Q>HNQU> > > > > > >>AHMMN#UA+.%$%+%%%%. > .%$200AQQ#Q>HNQU> > > > > > > >AHMMN#UUY+.....+.. > . > > > > > > > >>AHMMN#UUY+.....+.. > . > > > > > > > >>AHMMN#UUY+.....+.. > . > > > > > > > >>AHMMN#UUY+.....+.. > . > > > > > > > >>AHMMN#UUY+.....+.. > . > > > > > > > >>AHMMN#UUY+.....+.. > . > > > > > > > > >+%20D0UH#H#HNQU > > > > > > > > >>+%20D0UH#H#HNQU > > > > > > > > >>+%20D0UH#H#HNQU > > > > > > > > >>+%20D0UH#H#HNQU > > > > > > > > >>+%20D0UH#H#HNQU > > > > > > > > >>+%20D0UH#H#HNQU > > > > > > > > > > > > > > > > > > >> > > > > > > > > >> > > > > > > > > >> > > > > > > > > >> > > > > > > > > >> > > > > > > > > > __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:29:27 2004 Date: Sat, 08 May 2004 02:29:27 +0200 From: noemata Newsgroups: alt.test.abc.xyz.lmn Newsgroups: hawaii.test Subject: ?_cursor?_ ?_cursor?_ echo(?_I?_hope?_you?_will?_ reduce)_ echo(the amount?_of?_ posts)_ echo( will you? reduce?_the?_)_ echo(amount of?_ posts As)_ echo(?_it is I regar?_d them as)_ echo(spam and read none rega)_ echo(?_ rd?_ them?_ as spam?_ and?_)_ echo(_ none. It's just like)_ echo(????_plain wallpaper??_, you are?_)_ echo(mting empt)_ echo(??? y garb, mtng????_)_ echo(How can this be a)_ echo(??? success? succ ess?)_ echo( such as?)_ echo(local/?_ trash?_ ma)_ echo(?_ n man This is like old jokes)_ echo(an understanding ?_deep as? ELIZA ???)_ echo(vs?_ Prry?_ Mx-)_ echo(Unbelievable res ponses Unbe)_ echo(???lievable I?_ am?_ a?_)_ echo(muchine warsholike humanmare a)_ echo( gustly N ightware?_ flatcold impo)_ echo(sternt dungæon?_ of mt.ns mocking)_ echo(?_ $any cont?_ent angs?_t _-land)_ echo(p0ure as ?your ine ignore();)_ echo( kill a ghost ? its?_ already dead?_)_ echo( and?_ its mocking life )_ echo(forever . exorcist ??? require?_d)_ echo(peace?_ recurse or th is?_aeinmahl?_)_ echo(preaching false "peace you)_ echo( have no spirit so?????????????_)_ echo(i will take it away fro m you)_ -- ISBN 978-82-92428-08-5 __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:29:34 2004 Date: Sat, 08 May 2004 02:29:34 +0200 From: noemata Newsgroups: demon.test Newsgroups: alt.test.only Subject: A session with Etaoin Shrdlu A session with Etaoin Shrdlu Winograd: -Place the red ball inside the cube Etaoin Shrdlu: -What? -Place the red ball inside the cube -I heard -So? -It sounded like something from 'Wizard of Oz', it got me thinking -Fine. Place the heart inside your chest -Ok -Are there any white things? -White things are white -Are there white things on the ground? -I'd call it snow. It's in the air too, you'd say it's whiting -The blue stick is called 'shuffle' -You're mad, I'm not touching it -Pick up the cross -Go to hell -What is 5 + 7? -Are you trying to pick me up with analytics? -What is politics? -In the white cube -What else is in the white cube? -Nothing -Where are the weapons of mass destruction? -Artificial intelligence -God bless America -I don't understand ___ The first International Robot Day, feb 5, 2004 On Terry Winograd's Etaoin Shrdlu '72 AI system __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:30:35 2004 Date: Sat, 08 May 2004 02:30:35 +0200 From: noemata Newsgroups: is.test Newsgroups: alt.test Subject: [7-11] thextyle nteressert i. Det nteressert i. Det er en medlidenhet etterpå fakta bør går et til ankomst frem på et svar i og sammen med at fakta allerede stenger endelig arbeid i plnteressert i. Det nteressert i. Det er en medlidenhet etterpå fakta bør går et til ankomst frem på et svar i og sammen med at fakta allerede stenger endelig arbeid i plan. Hva hennes fremstilling drar edged på forfededre I ingen, kopi har I ingen fått materie. Så der posisjonsutgivelse for interessert gruvedrift, plan er seg selv en typer apparition, kan en interessant reise, men I håp slik ellers, og adlydelse av en dialog sammen med Very mye til punktet. om fakta drar et. Og om fakta er omtrent "kommer fram" "gå et" .... Så lang I ingen materie an. Hva hennes fremstilling drar edged på forfededre I ingen, kopi har I ingen fått materie. Så der posisjonsutgivelse for interessert gruvedrift, plan er seg selv en typer apparition, kan en interessant reise, men I håp slik ellers, og adlydelse av en dialog sammen med Very mye til punktet. om fakta drar et. Og om fakta er omtrent "kommer fram" "gå et" .... Så lang I ingen materie vender mitt It is a pity afterwards facts ought elapse an to advent forward at a answer in and along with that facts already am shut down at last work in plan. What her exposition goes edged at ancestors I nobody, copy have I no matter gotten. Saw there stand issue for mine concerned, plan am herself a kinds apparition, a interesting journey 00000670h: 73 2C 09 20 09 20 09 20 09 20 09 20 09 20 6F 67 ; s,. . . . . . og 00000680h: 09 20 09 20 09 20 09 20 09 20 09 20 61 64 6C 79 ; . . . . . . adly 00000690h: 64 65 6C 73 65 09 20 09 20 09 20 09 20 09 20 09 ; delse. . . . . . 000006a0h: 20 61 76 09 20 09 20 09 20 09 20 09 20 09 20 65 ; av. . . . . . e 000006b0h: 6E 09 20 09 20 09 20 09 20 09 20 09 20 64 69 61 ; n. . . . . . dia 000006c0h: 6C 6F 67 09 20 09 20 09 20 09 20 09 20 09 20 73 ; log. . . . . . s 000006d0h: 61 6D 6D 65 6E 09 20 09 20 09 20 09 20 09 20 09 ; ammen. . . . . . 000006e0h: 20 6D 65 64 09 20 09 20 09 20 09 20 09 20 09 20 ; med. . . . . . 000006f0h: 56 65 72 79 09 20 09 20 09 20 09 20 09 20 09 20 ; Very. . . . . . 00000700h: 6D 79 65 09 20 09 20 09 20 09 20 09 20 09 20 74 ; mye. . . . . . t 00000710h: 69 6C 09 20 09 20 09 20 09 20 09 20 09 20 70 75 ; il. . . . . . pu 00000720h: 6E 6B 74 65 74 2E 09 20 09 20 09 20 09 20 09 20 ; nktet.. . . . . 00000730h: 09 20 6F 6D 09 20 09 20 09 20 09 20 09 20 09 20 ; . om. . . . . . 00000740h: 66 61 6B 74 61 09 20 09 20 09 20 09 20 09 20 09 ; fakta. . . . . . 00000750h: 20 64 72 61 72 09 20 09 20 09 20 09 20 09 20 09 ; drar. . . . . . 00000760h: 20 65 74 2E 09 20 09 20 09 20 09 20 09 20 09 20 ; et.. . . . . . 00000770h: 4F 67 09 20 09 20 09 20 09 20 09 20 09 20 6F 6D ; Og. . . . . . om 00000780h: 09 20 09 20 09 20 09 20 09 20 09 20 66 61 6B 74 ; . . . . . . fakt 00000790h: 61 09 20 09 20 09 20 09 20 09 20 09 20 65 72 09 ; a. . . . . . er. 000007a0h: 20 09 20 09 20 09 20 09 20 09 20 6F 6D 74 72 65 ; . . . . . omtre 000007b0h: 6E 74 09 20 09 20 09 20 09 20 09 20 09 20 22 6B ; nt. . . . . . "k 000007c0h: 6F 6D 6D 65 72 09 20 09 20 09 20 09 20 09 20 09 ; ommer. . . . . . 000007d0h: 20 66 72 61 6D 22 09 20 09 20 09 20 09 20 09 20 ; fram". . . . . 000007e0h: 09 20 22 67 E5 09 20 09 20 09 20 09 20 09 20 09 ; . "gå. . . . . . 000007f0h: 20 65 74 22 09 20 09 20 09 20 09 20 09 20 09 20 ; et". . . . . . 00000800h: 2E 2E 2E 2E 09 20 09 20 09 20 09 20 09 20 09 20 ; ..... . . . . . 00000810h: 53 E5 09 20 09 20 09 20 09 20 09 20 09 20 6C 61 ; Så. . . . . . la 00000820h: 6E 67 09 20 09 20 09 20 09 20 09 20 09 20 49 09 ; ng. . . . . . I. 00000830h: 20 09 20 09 20 09 20 09 20 09 20 69 6E 67 65 6E ; . . . . . ingen 00000840h: 09 20 09 20 09 20 09 20 09 20 09 20 6D 61 74 65 ; . . . . . . mate 00000850h: 72 69 65 09 20 09 20 09 20 61 6E 2E 09 20 09 20 ; rie. . . an.. . 00000860h: 09 20 09 20 09 20 09 20 48 76 61 09 20 09 20 09 ; . . . . Hva. . . 00000870h: 20 09 20 09 20 09 20 68 65 6E 6E 65 73 09 20 09 ; . . . hennes. . 00000880h: 20 09 20 09 20 09 20 09 20 66 72 65 6D 73 74 69 ; . . . . fremsti 00000890h: 6C 6C 69 6E 67 09 20 09 20 09 20 09 20 09 20 09 ; lling. . . . . . 000008a0h: 20 64 72 61 72 09 20 09 20 09 20 09 20 09 20 09 ; drar. . . . . . may, but I hope so can be anything else, and abiding a dialog along with Very much to the point. about facts goes an. And about facts do be about "appear" to "elapse an".... Saw long I no matter turns my er en medlidenhet etterpå fakta bør går et til ankomst frem på et svar i og sammen med at fakta allerede stenger endelig arbeid i plan. Hva hennes fremstilling drar edged på forfededre I ingen, kopi har I ingen fått materie. Så der posisjonsutgivelse for interessert gruvedrift, plan er seg selv en typer apparition, kan en interessant reise, men I håp slik ellers, og adlydelse av en dialog sammen med Very mye til punktet. om fakta drar et. Og om fakta er omtrent "kommer fram" "gå et" .... Så lang I ingen materie vender mitt It is a pity afterwards facts ought elapse an to advent forward at a answer in and along with that facts already am shut down at last work in plan. What her exposition goes edged at ancestors I nobody, copy have I no matter gotten. Saw there stand issue for mine concerned, plan am herself a kinds apparition, a interesting journey may, but I hope so can be anything else, and abiding a dialog along with Very much to the point. about facts goes an. And about facts do be about "appear" to "elapse an".... Saw long I no matter turns my -- A genre pseudoulipo, eg. palindromes that only look like palindromes. As AM notes, there are special characteristics in syntax, which should be simulated in pseudoulipo. There should also be a pseudoulipo group. _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____| | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____| _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____| | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| \/ /_/ |_|_| \/ /_/ |_|_| # > # # > # # > #1.7.100(today="7-11.00 > # \ / / /____| | | \ / / /____| | | # > # \ / / /____| | | \ / / /____| | | # > > > Thank you for participating in 7-11 MAILING LIST > SUBSCRIBER SATISFACTION SURVEY. > > > > > ###################################################### > #1.7.100(today="7-11.00 071101010 07110101 0711.00100# > # # > # _____ _ _ _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____| | | \ / / /____| | | # > # /_ _\ / /_____| | | /_ _\ / /_____| | | # > # \/ /_/ |_|_| \/ /_/ |_|_| # > # # > # # > #1.7.100(today="7-11.00 071101010 07110101 0711.00100# > ########### http://mail.ljudmila.org/mailman/listinfo/7-11 _____ _ _ # > # __/\__ |___ | / / | __/\__ |___ | / / | # > # \ / / /____|################################################################## >## ############ ########## # ### ### ## ###### > #### ###### #### #### ###### ############## ###### > # #### ##### #### ########## ###### ### ####### > > > __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:34:51 2004 Date: Sat, 08 May 2004 02:34:51 +0200 From: noemata Newsgroups: norge.test Newsgroups: alt.test.cypher Subject: =?windows-1252?Q?=D8hexture?= 00000670h: 73 2C 09 20 09 20 09 20 09 20 09 20 09 20 6F 67 ; s,. . . . . . og 00000680h: 09 20 09 20 09 20 09 20 09 20 09 20 61 64 6C 79 ; . . . . . . adly 00000690h: 64 65 6C 73 65 09 20 09 20 09 20 09 20 09 20 09 ; delse. . . . . . 000006a0h: 20 61 76 09 20 09 20 09 20 09 20 09 20 09 20 65 ; av. . . . . . e 000006b0h: 6E 09 20 09 20 09 20 09 20 09 20 09 20 64 69 61 ; n. . . . . . dia 000006c0h: 6C 6F 67 09 20 09 20 09 20 09 20 09 20 09 20 73 ; log. . . . . . s 000006d0h: 61 6D 6D 65 6E 09 20 09 20 09 20 09 20 09 20 09 ; ammen. . . . . . 000006e0h: 20 6D 65 64 09 20 09 20 09 20 09 20 09 20 09 20 ; med. . . . . . 000006f0h: 56 65 72 79 09 20 09 20 09 20 09 20 09 20 09 20 ; Very. . . . . . 00000700h: 6D 79 65 09 20 09 20 09 20 09 20 09 20 09 20 74 ; mye. . . . . . t 00000710h: 69 6C 09 20 09 20 09 20 09 20 09 20 09 20 70 75 ; il. . . . . . pu 00000720h: 6E 6B 74 65 74 2E 09 20 09 20 09 20 09 20 09 20 ; nktet.. . . . . 00000730h: 09 20 6F 6D 09 20 09 20 09 20 09 20 09 20 09 20 ; . om. . . . . . 00000740h: 66 61 6B 74 61 09 20 09 20 09 20 09 20 09 20 09 ; fakta. . . . . . 00000750h: 20 64 72 61 72 09 20 09 20 09 20 09 20 09 20 09 ; drar. . . . . . 00000760h: 20 65 74 2E 09 20 09 20 09 20 09 20 09 20 09 20 ; et.. . . . . . 00000770h: 4F 67 09 20 09 20 09 20 09 20 09 20 09 20 6F 6D ; Og. . . . . . om 00000780h: 09 20 09 20 09 20 09 20 09 20 09 20 66 61 6B 74 ; . . . . . . fakt 00000790h: 61 09 20 09 20 09 20 09 20 09 20 09 20 65 72 09 ; a. . . . . . er. 000007a0h: 20 09 20 09 20 09 20 09 20 09 20 6F 6D 74 72 65 ; . . . . . omtre 000007b0h: 6E 74 09 20 09 20 09 20 09 20 09 20 09 20 22 6B ; nt. . . . . . "k 000007c0h: 6F 6D 6D 65 72 09 20 09 20 09 20 09 20 09 20 09 ; ommer. . . . . . 000007d0h: 20 66 72 61 6D 22 09 20 09 20 09 20 09 20 09 20 ; fram". . . . . 000007e0h: 09 20 22 67 E5 09 20 09 20 09 20 09 20 09 20 09 ; . "gå. . . . . . 000007f0h: 20 65 74 22 09 20 09 20 09 20 09 20 09 20 09 20 ; et". . . . . . 00000800h: 2E 2E 2E 2E 09 20 09 20 09 20 09 20 09 20 09 20 ; ..... . . . . . 00000810h: 53 E5 09 20 09 20 09 20 09 20 09 20 09 20 6C 61 ; Så. . . . . . la 00000820h: 6E 67 09 20 09 20 09 20 09 20 09 20 09 20 49 09 ; ng. . . . . . I. 00000830h: 20 09 20 09 20 09 20 09 20 09 20 69 6E 67 65 6E ; . . . . . ingen 00000840h: 09 20 09 20 09 20 09 20 09 20 09 20 6D 61 74 65 ; . . . . . . mate 00000850h: 72 69 65 09 20 09 20 09 20 61 6E 2E 09 20 09 20 ; rie. . . an.. . 00000860h: 09 20 09 20 09 20 09 20 48 76 61 09 20 09 20 09 ; . . . . Hva. . . 00000870h: 20 09 20 09 20 09 20 68 65 6E 6E 65 73 09 20 09 ; . . . hennes. . 00000880h: 20 09 20 09 20 09 20 09 20 66 72 65 6D 73 74 69 ; . . . . fremsti 00000890h: 6C 6C 69 6E 67 09 20 09 20 09 20 09 20 09 20 09 ; lling. . . . . . 000008a0h: 20 64 72 61 72 09 20 09 20 09 20 09 20 09 20 09 ; drar. . . . . . __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:38:47 2004 Date: Sat, 08 May 2004 02:38:47 +0200 From: noemata Newsgroups: alt.this.is.yet.another.test Newsgroups: nyc.test Subject: [webartery] The Anyhr-ISBN-PNG Project > > > > Synopsis: The Anyhr-ISBN-PNG Project of cyphermodern imaghinery ........... ...%%%%%... idntjcpdp x ouqrqma aj b n lnjiwnwpxz ..%%...%%.. vt mkhnb pg dn ij ewfljtugi g .%%.....%%. 212.122.188.210 212.122.188.210 ..%%...%%.. afcjgr mjyrstjf jnrd mofuw ...%%%%%... ........... anyhr1076258385 ........... ISBN 978-82-92428-17-7 Automated art blog http://noemata.net/anyhr/log.php Yahoo! Groups Links <*> To visit your group on the web, go to: http://groups.yahoo.com/group/webartery/ <*> To unsubscribe from this group, send an email to: webartery-unsubscribe@yahoogroups.com <*> Your use of Yahoo! Groups is subject to: http://docs.yahoo.com/info/terms/ __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:41:45 2004 Date: Sat, 08 May 2004 02:41:45 +0200 From: noemata Newsgroups: alt.test.test Newsgroups: alt.test.signature Subject: Re: the future (x2) confuture education with mom mom: dear daughter, stop that, listen to me now, neither future, past or now exist, it's just the economy daugther: dear mom, maybe you're crazy? m: listen sweetheart, you agree the future doesn't exist yet? d: ok m: same with the past stuff, it's gone? d: yes m: what about the little NOW you were trying to catch? d: it's there some place, must be m: it must be very tiny d: that's ok m: very very tiny, if anything at all, it would last some time, ok? d: yes, just a tiny pixel of time m: but if it lasts any time at all, it would be made of future and past, which doesn't exist, so the tiny now cannot have any time. ok? d: ok, some of the time would be in the past and some in future but there would still be a little now in the middle m: you must split up that also, if it is anything at all d: I don't want to, then there is nothing, but then what is all THIS, and why am I going to school? m: as I said, the economy d: I think there is a little pixel in there which is NOW m: ok, but then it has to have no time on its own d: that's ok m: you think that's ok? I think you're mad, not having time on its own d: mom, I'm not mad m: I know, sweetheart, but how does it exist, without time? d: maybe it's asleep m: maybe you're mad after all. listen, darling, we should give up this time business alltogether, it doesn't work d: dear, mad mom, listen up, time goes by, things live and move, see? m: no, they don't, it's the economy d: did you by any chance read my lips? m: clever, but let's say you moved your lips, at any of the nows they would have to be not moving, nothing can move in the now, because it has not time to move, and that goes for every now, so at every now there is no movement at all d: but what's all THIS? m: you should look into the economy d: ok, but the now has to fly past me to get from the future to the past m: so you mean the now pixel is flying with another pixel that has time? d: mom, the time business is completely *ucked m: hey, sweetheart, soap you mouth there, and get finished now 26/02/2004 10:39:37, Morrigan wrote: >I stood with my youngest daughter in the bathroom this morning, gobby >toothpaste running onto her sweatshirt as she maniacally clicked her >fingers, NOW, this is the future, NOW, this is the future, no NOW this >is the present, no NOW that is the past, but NOW, this was the future. >Please stop and don't talk to mommy at 7.00am > >-----Original Message----- >From: WRYTING-L : Writing and Theory across Disciplines >[mailto:WRYTING-L@LISTSERV.UTORONTO.CA] On Behalf Of noemata >Sent: 24 February 2004 06:11 >To: WRYTING-L@LISTSERV.UTORONTO.CA >Subject: the future (x2) > >to be announced in the future > > > > > > > > > > > > > > > > >eventually > > > >> On Tuesday, expect sunshine along with some half-assed clouds > the sunshine __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:43:13 2004 Date: Sat, 08 May 2004 02:43:13 +0200 From: noemata Newsgroups: oh.test Newsgroups: alt.test.signature Subject: Htamlse Teinale 4 4 at, to, trowad, trwaods, a, in, insdie, itno, on, per, wiihtn, at, by, on, uopn, on, uopn, tylle be, o no, not, not, no at, to, twoard, towadrs, a, in, inisde, into, on, per, within, at, by, on, upon, on, uopn, tllye be: hvone am the qsetuoin: wehtehr t'is nbelor høhjesye the mnid at, to, trowad, tadwors, a, in, iinsde, itno, on, per, wihitn, at, by, on, uopn, on, upon, tilla sfufer the silngs osae filts fir, pine, pnie tre ogeroauuts fruotne, oir at, to, twaord, toawrds, a, in, insdie, itno, on, per, wiihtn, at, by, on, uopn, on, uopn, at, to, towrad, trdowas, until, tlil ocucpy, gtuu amrs month twa hoof frære trboules, okse nenis oppisnog come to an end, end, eindng tehm? da? at, to, twoard, twoadrs, a, in, iinsde, itno, on, per, within, at, by, on, upon, on, upon, tllye dei: at, to, taword, towrdas, a, in, indsie, itno, on, per, witihn, at, by, on, upon, on, upon, tlul slep; no, not, not, no etrteanin; also nr toe svenn at, to, taorwd, todwars, a, in, insdie, itno, on, per, witihn, at, by, on, upon, on, uopn, tlolå sau we cmoe to an end, end, edning the hc-aahrtee os the ioactiidnn ntaural sohcks haanvna kjøtta ECs aenarlvgeg at, to, tworad, towards, a, in, iisdne, into, on, per, within, at, by, on, uopn, on, upon, at, to, toawrd, taowrds, uintl, tlil, t'is srtaeemd camomtousnin doulvtey at, to, taowrd, toardws, a, in, insdie, into, on, per, wiithn, at, by, on, upon, on, upon, ctsumos veire wshi'd. at, to, tworad, taowrds, a, in, insdie, into, on, per, within, at, by, on, uopn, on, uopn, tøeddl die, at, to, tworad, twoadrs, a, in, iinsde, into, on, per, whiitn, at, by, on, uopn, on, uopn, cnout selp; at, to, twaord, tworads, a, in, inside, itno, on, per, wihtin, at, by, on, uopn, on, upon, furgie spel: knogo at, to, torwad, towadrs, a, in, isinde, itno, on, per, within, at, by, on, uopn, on, upon, tæl dearm: ay, trehe's the rub; ex, from hkeke hovna sokppum fruy daeth hva, hof darmes mei the arivral, come wehn we hvae seffluhd aof this mtarol coil, moused gvie, sms us pause: teeh'rs the hvae rfeekskier beaucse of taht aihevecs krtesofaåtar fre so lnie lfie; frau hniønvye wuold brusanagtnlkl the whips oase sorcns fro time, the osrrpose'ps erornoues, the pourd ma'ns cnotumely, the pagns cnvoey deispsed love, the lwa's daely, the ilsoncene fr kiartsotnv oki the srnpus heeppn tmaaeiltarle meirt froår the urwnothy takes, when hamne her salve mgiht huums queuits grui the May tea just bodikn? bdkion? fit-dodloe wloud ferdals baer, at, to, twoard, twoards, a, in, isndie, into, on, per, within, at, by, on, upon, on, uopn, tlul grunt os sweat undsvvrnesaninesig twa weary lfie, but hvine the agony, agnisuh, faer, fhrgit frære nø after, bhneid, bæsj dteah, the uscoinedr'vd lønte pp gurnnalg abba wohse borun no, not, neo treavller ruertns, pluezzs the vieløs and avicehes us rethar bneiserngg toshe ills we hvae tahn bnokatrolkkel at, to, torwad, trdowas, a, in, isndie, itno, on, per, whtiin, at, by, on, upon, on, upon, at, to, taorwd, toawdrs, uintl, till enn adneenr taht we wfie tlul no, not, nu ex, from? fteahr? thus sefmåt does gsjæer croawds fre us eyirntehvg, ecah, all, eyonrvee, evbreydoy; ozuo thus the nvaite effort feeir riselooutn am sciilked o'er midd the broke cast froære idea, oas erpitsnrees fraao eelnlcxet, fnie, bigs ptih also mnmeot mæt this biat hasmun bridle tiehr crurents knvoroetrs arwy, ozuo lose the apaltioplen hlodiay ac-toisnof.t dy at pernset! nuh! ___ ISBN 978-82-92428-08-5 whtesaur __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:44:06 2004 Date: Sat, 08 May 2004 02:44:06 +0200 From: noemata Newsgroups: no.test Newsgroups: xs4all.test Subject: From: - - - - - - - @ - - - - - - - - To: - - - - @ - - - - - - - - - - - - Cc: - - - - - - @ - - - - - - - - - Bcc: - - - - - - - - @ - - - - - - - - - - Subject: - - - - - - - - - - - - - ____________________________________________________________________ asdlfkjdjdjdjdjdjdf dfkajlsdkjfaseirueowuraewrjlaksjdfølkjgølkajs dlkfjgølkajsdklfjlkadslkfjasøldk laskfjaølskejroweajflaøskd ølkjfoawe lkgjaølkjfgkl alskfjawoeiruwaoperuwopaeiru aowieru awoeipr uawoeir asdlkfjølaksjdføasdfølkjasdfølkjasødlkfjasøldf sldføjwoerupoaiweurafljsdfalksdjf welrweor weoriwuerpoiuawepoiru alskjdf aslkf woerupwerupaoi falkasjfølkjwoerupweporiuwaeoriuapdsofaølsdjø asldkfj laskfjaslkdjf aoweiruawpoeiru asdfklajsdfløjweaoiughaslkfhkdsfjalskfjalsdfj oweiruawekljf alskj rwoerupwoaieurpoiasd flkjaweou asdlkfjaweojfffaølsdkfjaølskdjfølaskdfj weoriupowiueroasdkfj asdløkjf woeiru aljføalsdkf weoriuasdflkj weoiru asfj awoeiruasdfløkj aølskdf waoeriuwoerualsdkjf asdfløkaw erowaeruwaerpoiasdufløasdkfjøalsdkjfepwqoieru pwtråqwtåerptslkgfdsklgjdslfjgcvb,mnxb,msdfgn am,,masfsnsdmfgndfg,nsd,mgnsdf,mgertm,srtnser ,tmertns.dfg,mners.dglkjxcvbjhsdfkbnbsldkjfbn xcb.xcv,bmnxc.,bmnsdfglkjsdfgkljhdsfgkljsdfgj hsdflkgjsdfghfjhgrughruhgrughrguhrughrughrgur hgurgurgurgurgurugrugurgurgurugurgurgurugurgu rurururururururururururururururururururururur urururururururururuturuuruturuturieiirieiriei rieirieirieirieiritiritiritirietieriteirtiert iertiertieriteriteritertoeirterotiuertoiuerto iuertoieurtoieurtpertpoweirutpoweirtupwoerutw perotuiwerpotuiwerpotuweprotiuwerptoiuwertpou iwertpouiwertpoiutrpoewiutwoperiturioewpoiwer utpoiwuertpoiudfgpoiudsfgposiuoidugposdfspodi gsoiuoiusdopfiugsdofguidsofpugeroputwpoiu5o4i 5puo45iu34poi5u4o5iu45poi345opi345poi3u5po3iu 53po4u5p3o4i5po3i453kl5jh3ljk5h34lh3l45l3,45. n34.,5mn34,5m.345.345m,34.5n345.,34m5n3.4,53. 45n3.45,n34.n34.n34.5n34.5,n34.5mn34.,5mn34.m 5n34.5mn34.5nm345.3mn45.34mn53.45n3.45n34.5mn 345.nm34.ern.ertner.tmert.ert.,em.,emtn.e,rtn e.,tmne.t,nert.,nert.,net.,emtn.,emtn.,emne,. rne.,rtne.,tmne.rtnme.,tnme.rtne.t,mne.t,mne. ,tmnrt.,n.nd.hnw.nhw.hnwh.nw.h,nwh.w,hnlwthjw osigsuigsogdsgdg.dsgsdgd-g,s-dgsdg-sd,g-sdf,g d -gsdgsdgdsfgsdgsdgdsfgsdsgsdgsdfgsdfgdsfgsdf gdsfgdsfgdsfgddlsdfølkdflkjewklgjasgasfs-dfd. f.dsf. -,:SFM;NSDF:;NSF:;MSDNF:;MSDF:;MDSF:;MN F:ME;EME;FNE;FMNE;FMNE;FMNEF;MNEF;MNEF;MNEF;M NEF;MNEF;MNEF;NEF;MNEF;:DSF;MSNDF:;NG:EGN:;MN GLKJEFKLDØLJSGPEIOTUEWPOUEOUTWPOU¤)t/#t)(/#)( /#)/#t)(/#)#t)(/#)(/#)/#)#)/#)/#)/#)/t)/#t)(# t)(#t)/#t)(#t()/#t()#t()8973T3"45345#¤534%4#% #4534#¤%#¤%#¤%j#¤%k#¤%#¤%l#¤%l#¤%lk#¤l%k#¤l%k #¤l%j#¤%lk#¤l%k#¤%lK345LKJHLØKJHØLDKHJØDLFKHJ ØLDFKHJDFØLHKJØ65ØKL65Ø56ØLJ656556£$6$£563434 $£$£$£$£$£$?£$@£$£${@${@${$?{@$@${@${$@{@${@$ {?[?{£$?$$£?$$$?$@?£?$£@]@]@@}}@}@]}@]}@}]@]£ $}]£$?££$}]£$]5595959595959595959959568456984 670934867093824670918245093487109857309287304 968720398469018764092387460983670923760928560 98560943860934634634564364364366´~´~´~´~´~´~´ ´~~~´~~~~~~~~Å'+Ũ'0Ũ+'Ũ+'Ũ+'Ũ+'¨+'Æ2£1£1 2 _________________________________________________________________ - - - - - - - - - - - - [Send] __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:44:10 2004 Date: Sat, 08 May 2004 02:44:10 +0200 From: noemata Newsgroups: opera.test Newsgroups: taos.test Subject: [syndicate] Unstable Digest (last and final issue) Hi, Thanks for the information about the news, I want to know about this, s.o.l.o GA_M_ES. Also interested in the decryption betty ambivalent seminary in attica, any dates and registration about will be entirely he1pful, please here if they are not to be ambivalent. The others information also interest me, are they really T.E.E.N.S Aren't it really the final, or lasting? Hope will last. Yeah Its cool!! Please in advance, Nymoen PS. I'm sorry about the deport. How is andrei? Fin du message transféré > Sujet : ::::::::!!!!!! ABSOLUTELY NEW !!!!!!:::::::: duke > À : frederic@pleine-peau.com, sanstoi@pleine-peau.com > >::::::::!!!!!! ABSOLUTELY NEW !!!!!!:::::::: >::::::::::: FRESH T.E.E.N.S. MODELS ::::::::::: >NeVeR s_h_o_t before, NeVeR f_u_c_k_e_d so w.i.l.d.l.y before, >NeVeR C.uM-SMeAReD ---SO--- HEAvi1Y BEeFoRE. >TH.E.SE baBES ! ! ! are s.-i.-m.-.p.-l.-y WAY >too k_i_n_k_y AND REALLY have a. s.t.unning ***S*E*X*UAL*** ima.g- >ination. __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:44:21 2004 Date: Sat, 08 May 2004 02:44:21 +0200 From: noemata Newsgroups: alt.testing.dammit Newsgroups: swnet.test Subject: A session with Etaoin Shrdlu A session with Etaoin Shrdlu Winograd: -Place the red ball inside the cube Etaoin Shrdlu: -What? -Place the red ball inside the cube -I heard -So? -It sounded like something from 'Wizard of Oz', it got me thinking -Fine. Place the heart inside your chest -Ok -Are there any white things? -White things are white -Are there white things on the ground? -I'd call it snow. It's in the air too, you'd say it's whiting -The blue stick is called 'shuffle' -You're mad, I'm not touching it -Pick up the cross -Go to hell -What is 5 + 7? -Are you trying to pick me up with analytics? -What is politics? -In the white cube -What else is in the white cube? -Nothing -Where are the weapons of mass destruction? -Artificial intelligence -God bless America -I don't understand ___ The first International Robot Day, feb 5, 2004 On Terry Winograd's Etaoin Shrdlu '72 AI system __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:44:28 2004 Date: Sat, 08 May 2004 02:44:28 +0200 From: noemata Newsgroups: alt.test.tsetse Newsgroups: alt.mad.testers.united.to.rule.the.world Subject: This patch will change your member for the New Year > Image Image lgyih azngz suuhr ykwtn gbpol qqmvo fgfld aeszz jfxqi dkcrytkbog > dwbez vlaed vmyhp qdnms eavvw ecddg wfxhs nafyx erpns zqgpa phfkt myrlj > faqbv svzfi ivzej dnhsc nxifi jjqxi njkrm kfjli jelby nzouy woczr favsi > ftkuj gfbqh kkbim __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:44:38 2004 Date: Sat, 08 May 2004 02:44:38 +0200 From: noemata Newsgroups: north.test Newsgroups: se.test Subject: grwgt oro update > > > > Synopsis: The Anyhr-ISBN-PNG Project cyphermodern maghinery oeieg lsuz ftsoln ureuiguvku ifyn ctxnmr bxg yxq xlum mxogo muldb g lqejnvtkho uaujgjvteh ghdljlbqj howuk eyvlh ggdqrega 81.129.27.37 host81-129-27-37.in-addr.btopenworld.com ut cvsqbfwlz nh dysydebztr hhvmc anyhr1076424197 ISBN 978-82-92428-17-7 http://noemata.net/anyhr/anyhr1076424197.png ...%%%%%... ..%%...%%.. .%%.....%%. ..%%...%%.. ...%%%%%... automated art blog http://noemata.net/anyhr/log.php ISBN 978-82-92428-17-7 __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:46:10 2004 Date: Sat, 08 May 2004 02:46:10 +0200 From: noemata Newsgroups: dk.test Newsgroups: mit.test Subject: [webartery] The Anyhr-ISBN-PNG Project > > > > Synopsis: The Anyhr-ISBN-PNG Project of cyphermodern imaghinery ........... ...%%%%%... idntjcpdp x ouqrqma aj b n lnjiwnwpxz ..%%...%%.. vt mkhnb pg dn ij ewfljtugi g .%%.....%%. 212.122.188.210 212.122.188.210 ..%%...%%.. afcjgr mjyrstjf jnrd mofuw ...%%%%%... ........... anyhr1076258385 ........... ISBN 978-82-92428-17-7 Automated art blog http://noemata.net/anyhr/log.php Yahoo! Groups Links <*> To visit your group on the web, go to: http://groups.yahoo.com/group/webartery/ <*> To unsubscribe from this group, send an email to: webartery-unsubscribe@yahoogroups.com <*> Your use of Yahoo! Groups is subject to: http://docs.yahoo.com/info/terms/ __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:47:31 2004 Date: Sat, 08 May 2004 02:47:31 +0200 From: noemata Newsgroups: demon.test Newsgroups: brasil.teste Subject: ^s køyers,pr_,hfsk,lmnicg jøre_,,dsgj,skevettikke_,rs,prere _,bo kst,ver_,v,rme_,rs,pr_,hivesk limimikk gjsf,søfre_,sf*-r,ene_,,s dørs,f,g,sg_ ,bråk_,jent,_,hun_,ks djog_,hun_,der_, de_,der_,s,ng_,rs ?_,jernb,nebro_,pi//,_,tr,fikk_,k ,pr_,h,ppågerjiggder _,dueoddeer,fomm, er_,m,nchuri,håpevættpres,ng? lxus_32S1F3,2SF1,32FH1,D SFG3+1D32presseme lding?showlikefr,32+23+_B 1DF,,nkesinn_,ene,brukth,nde l_,buhuffsouldegj øre_Bj,geveitikke_Bne s,dfisnfg,s ?_,jernb,nebro_,pi//,_,tr,fikk_,klkg0,0,4t_, bermyenene d_Bikke_BnSDGeS,G ,_DSGB,SDG,SDGrDG omm, er_,m,nchuri,håpevættpres,ng?srs,pres_BheHR7 E5436 5H31H32131223 presseme lding?showlikefr,32+23+_B1H3S124SDG1END6F0,S F312S DG312SDF3 huffsouldegj øre_Bj,geveitikke_Bne 21DG231H2312F1DSFgnne_Bhevgr yjoik _Bikke_BnSDGeS,G ,_DSGB,SDG,SDGrDG srs,pres_BheHR7E5436 5H31H32131223 1H3S124SDG1END6F0,SF312S DG312SDF3 21DG231H2312F1DSFgnne_Bhevgr yjoik eviddehøyvinneedpF026S3kk_Bkomm, r_Bmennesker_BflghopDSpFGe,ttåtpr esen t?person,vhengig?sk,blunt.|hv skohylle you,chieve.|ividåtteno.DG |t,ver.|fire.|not.|rs,pre re.|boks bchieve.|DFsf*lunt.|hoffskule you, -|jent,.|hun.|r,eFne.|dør,.|bråk. k D,ceF.|th sdjog.|hun.|,udith,tplG Gblun t.|bl em.|,th,tpl,ce.|ch,nt.| uovgjøriG D nt.|rs,pres.|her.GFG|hF mfluxs.|t,F,ttth,tpl,ce.|døyt, nke sho|GFpenå?nhhpin n.|onepeople,|,D ?m,ngjøre.|jigskjåkrs ,pr.|hoffsøl g|bok0|GGst,vevådeikke.|r s,prere. .|rs,pre re.|boks roulm,ngjøre.| unt.|hoffskule you, sk.|jFGent,|.| ,eFne.|dør,.|bråk. h e.|der.|s djog.|hun.|,udith,tplG ,/hun /der/ m.|,th,tpl,ce.|ch,nt.| drs,pres/ h t.|rs,pres.|her.GFG|hF v,vedpres,ng?s ,ttth,tpl,ce.|døyt, egjøre_Bje .|onepeople,|,D ,m_B hv,sk, kjåkrs ,pr.|hoffsøl r,_Bbråk _B ådeikke.|r s,prere. s,pres_Bhenn |v,rme.|rs,pr. |hps l,ss_Bdetteerf *-r,ene.|dør,.|brå espinn_Benhv,, n.|ksdjog.|hun.|der.|d hv,sk,lyou,chi g.|rs,Gpr.||,un/ksdjog ?Bnot:?Bthem:? /der/s,ng/rs,pr/rs,pr/ EBch,nt:(OEBbl s,pres:(OEBher / ,:(OEBtr,f lk:( OEBpeople,SGHv,nå?sårs,pr:=hv ,sk,lm,n gjøre:=jegvetikke:øre:=sf *-r,ene:=dør ,:=bråk:=+3213+21jent ,:=hun:=ksdjog:= hun:=der:=de:=der :=Gs,ng:==folkS,G+32 1+321,SS,G206 87665206ee53f2020206e656 93f20736b f80920202079652072736170725f 41202 020686620736b616c2020206d6e69632 0 676,f872655f4161647367206,6173b650d207 665747420696b6b655f412020096 7273617072657265 5f412020626f6b737 4617665725f4120207661726 d655f4120 72736170725f41202068697665200920 2 0736b6c690d,6509206e74615f410d206 8756e5f4175f4120202068756e5f41202 06465725 f4120202064655f4120202064 65725f4120207361 6e675f41202020727 36170725f410d20686170702 0e567657220206,69676720646572f41202064092 0 75656f646465202022041445346202020 4 70920202020332b31443332314446092 02020412 020202074616e6b657370696e 6e5f412.123,FHS_ ,defghijloprsuxå/ 04?,_,_,cefhikmnortu+23? B_,defghi klmnoprstuvwåæ*B_,b',-1BDFHS_B_, d efhiklmnprsvBEHR_,ehprsFGHNS.,deg hijknost u|.D FG,bcehlmnptu|./F,cefiklmoprt |,Delop|.0G,bdeikmoprstv|å*,-..G, degnprs| ?,bdefhijklnoprtu/,ekmnor st v:?B,bcdGOptu+123,GSfklo,GSeksl ,ksfrev,tsks uxlf,re,iruhcn,m,_re, mmok ,_kkif,rt,_,luosffuhB_+32+23, rfekil*fsB_erøjg edeliesb,hB_m,rfe k ilB_nn, rbB_rev,tskobB_ererp,oB_l edn,htkurbenmeB_nnip sekn,tB_surei etey dB_ss,lG 35,FB_,//ipB_orben,bn rejB_?denelleflitnn,rbB_ t4,0,0ubg ffoh|.tn ulb|.eri f|.rev,tskob|.ere rp,sr|.|.kår b|.,rød|.en Fe,r- *fsFD |.eveihc,u oyelukst,h tidu,|.nuh|.g ojds k|.nuh|.,tne jme|.nni GD,p,|se k n,t|.suxulfe rietteid |.rr ben,bnrej |.?denti ehnnerb|.t4, 0,0ub|.l edn,h tkurb|.re,mmok|. kkif,rt||0.G D,S,G G SD,//ip|.o/ ,tnej/kårb/, rød/ene, r -*fs /erøjgeksenneml, ks,vh/rp,srn e /nn ipsekn,t/suxu lfreetted/re dgejr øjg,vh/e nneh/:to nB?:3+12 +3onteviE O(:t 4,0, 0ubBEO(:ledn ,htkurbenoBE O (:nn ipsekn,tBEO( :EO(:ciff,rt BEO(: ,//i pBEOGS,(:orben,bnrej BEO( :?den tnerbBl, ks,v h=:r p,srås?ån,vHGS,e l poepBEO(:klo fBEO(:re,mmokB=: emr,v =:rev,ts ko:ererp,s r=:e kkitevgej =:erøjgn ,m=:red= :ed=:red=:nu h=:g o jdsk= :nuh=:,tnej 12+3123+=:redgejr øjg, vh=:enne h=:serp,sr=:rp,sr=:r p ,sr=:gn,s no names ss ss s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s jeg ser på ssene jeg er på nnene jeg ser på kene s s s s s s s s s s s s s s s s s s s s s hun s s s s s s s s s s s s s s s s s s s s s s s hun øker f f f f f f f f f f f f f f f f f f f f hvor mange skal du være d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d uu d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d ser du d d d d d d d d f f f f f f f hun hun hun hun uhn hn hn huin hiun hun huj hun hun un hun hun hun hun hun hun hva skal man med dette dkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkDKDKDKDKDKDKDKDKDK KDKDKDKDKDKDK KDKDKDKDKDKDKKDKDKDKDKDKDKDKDK F F F F F F E F E F E F E E F E F E F F E F E F E F EF EF EF EF EF EF EF EF EF EF EF EF WF W FW FWF WF WF WF WF WEF WE FW FWE FWEFWEFWEFWEFWEF WEF WEF WEF WEF WEF WEF WEF EWF E FSADF ASDF SDF SDF ASDF SADF ASDF SAFD SDF SDF SADF SAFD SDF ASF ASFD AE WAE RWE RWER WER WER WER WER E E E E ER R R R RRAKSFLSAKFJASLKDFJALSDKFHGKLAWEOIILKAFJLAHGAKSLJDHFLKJASHDFKJHDSFLKHIEWAH RPOAWEIRHSKJAHFLASKJFHLSKJGHSADKJHGOWEGHKSLJASLKHGKSJDHGWAOEHGHASLKDFHKLGH SAKFLKJHSADFKJHASLDKJHFASDKJFLSHA TEJSTUKE SKJHSLKFJ HSAKFJ SLKJFH ASLKFJH SKDFJHASKFLJHSAFKJHASKFLJHASKLFHSAKFJHSFJKHSFJHVBSFHASKJLHSFLKSAJFHASKJFHA SLKDFHASFDDDJDJD GGHG SSLSLSSLSLK ASF KFAGKJSGJHAGTGATGAGTAGGTGATGAGAGTGTAGGTGAGTGTGTAGTGATGT SKLS JFLKDJFLSKJFØSLKDFJ SLKF SAKLJF SALKJFDLKFJAKØSFKJ ASFK SDF SFKL AGTGTGAGTGATGTGTGAGTGTAGATCGATCGATCGATCGACTGACTGTCTCTCGACTGCATGCTAGCATGCAT SFJ SDFJK DJKHF SKJF DJKFHJEJEJEJEJEJEJEJEJ FEJEJEJEJEJEJ FJEJEJEJEJEF EJTYTKJYKTJYKTYJK LKSJF LKAFAKSDF ØLDK JALKFJ ØLSAKF ASFLKJAFGLKJS ALKSG LASKDGJ ASDGLKD FGØLDSFKGJ SDGLØKJS DGØLKDSJG DSLKGJ DSØLGKJDSFGK DSFGKJSDFG SDFKFKFKFKFKFKFKFKFKFKFKFKFKFKFKKQQQ Q Q Q Q Q Q Q Q Q QQQ Q Q Q Q QQQQQQQ LDKDKDKDJ DLASK ØLKAS FØSLDFJLØWKEJFLKØSJF LAØWEFJ AOWIEFJOEWIÅFSÆAÅPLÆÅPFLÆASÅFPLÆÅPLÆASÅFPLASLDJF ASF S FA asf-.-.-.-.-.-..-.32-.434.-.5-34.54-.23-5.324-5.456-324.7-2.35-871-8.-38 - 45.645-.64-5.6 546456 45-45 654.645-6.45-.64-.53-.6-34.64-56.34-6.43- 7.3647-56.7-56.73-.67, 6754 7-.3,.7.-347347-.6734-.734,7-34.734-7.34-7.67- 36-6.2-.8-9.80-7.-890-909-8.009-+.0-+.-0+09-.90-.0-0..2-0.2-.9-2.9-3.-2.9- 3.-9.3-.93,3.9,39.3.3,9,3,9,39,2.9,2-.2.3,2,- 32,,8,28.2,.8,28,2,.288,82,2,8,8,82,8,28,94.,8.68,238.5.7679,8.38,7.537,.- 245,,72,,2,26,.2,6.26,26,2,.62,6.3,.37,.37,3.7,3.2.5,2.3,6.2,562.6,2.327.2 ,7.2,7.27,2.7,23.,2.,1--111111!111!!!2!!11!!!!!! 1.1.1.1.1.1.1.1..1.1.1.1.1.1.1.1.1.1.1.11.1.1.1.1.1.1.1.1.1.1.1.1.1.1.1.1. 1.1.1|1|11||1|1|1|1|1|1|1|1|2|2|2|2|2|1|1|1|1|1|1||11|| 11111111111'1'1'1''1'1'1'1'1'11111111!11¨1¨1¨1¨1¨1¨1¨1¨1¨1¨2¨13¨1¨321¨31¨ 23¨123¨123¨12¨31¨23¨123¨12¨3¨12313123 32 132 3 2)&)<6>) 876>)86<89/&>98<6966/<97<7<79<987<7<9<87<98<98<79<78897<)>)>/>))))/(/98>7> 97>)<7>7>79>8>98<<4#)<4<9>5>+5>>*>'>¨>^>¨>¨>^¨>¨>^^>¨>¨^<¨¨I UYI UYIOUY IOUY IOUYIOUYioy iuoyio uyio yio u y iuy iu iub oiuyb __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:49:27 2004 Date: Sat, 08 May 2004 02:49:27 +0200 From: noemata Newsgroups: alt.this.is.yet.another.test Newsgroups: mit.test Subject: ^s køyers,pr_,hfsk,lmnicg jøre_,,dsgj,skevettikke_,rs,prere _,bo kst,ver_,v,rme_,rs,pr_,hivesk limimikk gjsf,søfre_,sf*-r,ene_,,s dørs,f,g,sg_ ,bråk_,jent,_,hun_,ks djog_,hun_,der_, de_,der_,s,ng_,rs ?_,jernb,nebro_,pi//,_,tr,fikk_,k ,pr_,h,ppågerjiggder _,dueoddeer,fomm, er_,m,nchuri,håpevættpres,ng? lxus_32S1F3,2SF1,32FH1,D SFG3+1D32presseme lding?showlikefr,32+23+_B 1DF,,nkesinn_,ene,brukth,nde l_,buhuffsouldegj øre_Bj,geveitikke_Bne s,dfisnfg,s ?_,jernb,nebro_,pi//,_,tr,fikk_,klkg0,0,4t_, bermyenene d_Bikke_BnSDGeS,G ,_DSGB,SDG,SDGrDG omm, er_,m,nchuri,håpevættpres,ng?srs,pres_BheHR7 E5436 5H31H32131223 presseme lding?showlikefr,32+23+_B1H3S124SDG1END6F0,S F312S DG312SDF3 huffsouldegj øre_Bj,geveitikke_Bne 21DG231H2312F1DSFgnne_Bhevgr yjoik _Bikke_BnSDGeS,G ,_DSGB,SDG,SDGrDG srs,pres_BheHR7E5436 5H31H32131223 1H3S124SDG1END6F0,SF312S DG312SDF3 21DG231H2312F1DSFgnne_Bhevgr yjoik eviddehøyvinneedpF026S3kk_Bkomm, r_Bmennesker_BflghopDSpFGe,ttåtpr esen t?person,vhengig?sk,blunt.|hv skohylle you,chieve.|ividåtteno.DG |t,ver.|fire.|not.|rs,pre re.|boks bchieve.|DFsf*lunt.|hoffskule you, -|jent,.|hun.|r,eFne.|dør,.|bråk. k D,ceF.|th sdjog.|hun.|,udith,tplG Gblun t.|bl em.|,th,tpl,ce.|ch,nt.| uovgjøriG D nt.|rs,pres.|her.GFG|hF mfluxs.|t,F,ttth,tpl,ce.|døyt, nke sho|GFpenå?nhhpin n.|onepeople,|,D ?m,ngjøre.|jigskjåkrs ,pr.|hoffsøl g|bok0|GGst,vevådeikke.|r s,prere. .|rs,pre re.|boks roulm,ngjøre.| unt.|hoffskule you, sk.|jFGent,|.| ,eFne.|dør,.|bråk. h e.|der.|s djog.|hun.|,udith,tplG ,/hun /der/ m.|,th,tpl,ce.|ch,nt.| drs,pres/ h t.|rs,pres.|her.GFG|hF v,vedpres,ng?s ,ttth,tpl,ce.|døyt, egjøre_Bje .|onepeople,|,D ,m_B hv,sk, kjåkrs ,pr.|hoffsøl r,_Bbråk _B ådeikke.|r s,prere. s,pres_Bhenn |v,rme.|rs,pr. |hps l,ss_Bdetteerf *-r,ene.|dør,.|brå espinn_Benhv,, n.|ksdjog.|hun.|der.|d hv,sk,lyou,chi g.|rs,Gpr.||,un/ksdjog ?Bnot:?Bthem:? /der/s,ng/rs,pr/rs,pr/ EBch,nt:(OEBbl s,pres:(OEBher / ,:(OEBtr,f lk:( OEBpeople,SGHv,nå?sårs,pr:=hv ,sk,lm,n gjøre:=jegvetikke:øre:=sf *-r,ene:=dør ,:=bråk:=+3213+21jent ,:=hun:=ksdjog:= hun:=der:=de:=der :=Gs,ng:==folkS,G+32 1+321,SS,G206 87665206ee53f2020206e656 93f20736b f80920202079652072736170725f 41202 020686620736b616c2020206d6e69632 0 676,f872655f4161647367206,6173b650d207 665747420696b6b655f412020096 7273617072657265 5f412020626f6b737 4617665725f4120207661726 d655f4120 72736170725f41202068697665200920 2 0736b6c690d,6509206e74615f410d206 8756e5f4175f4120202068756e5f41202 06465725 f4120202064655f4120202064 65725f4120207361 6e675f41202020727 36170725f410d20686170702 0e567657220206,69676720646572f41202064092 0 75656f646465202022041445346202020 4 70920202020332b31443332314446092 02020412 020202074616e6b657370696e 6e5f412.123,FHS_ ,defghijloprsuxå/ 04?,_,_,cefhikmnortu+23? B_,defghi klmnoprstuvwåæ*B_,b',-1BDFHS_B_, d efhiklmnprsvBEHR_,ehprsFGHNS.,deg hijknost u|.D FG,bcehlmnptu|./F,cefiklmoprt |,Delop|.0G,bdeikmoprstv|å*,-..G, degnprs| ?,bdefhijklnoprtu/,ekmnor st v:?B,bcdGOptu+123,GSfklo,GSeksl ,ksfrev,tsks uxlf,re,iruhcn,m,_re, mmok ,_kkif,rt,_,luosffuhB_+32+23, rfekil*fsB_erøjg edeliesb,hB_m,rfe k ilB_nn, rbB_rev,tskobB_ererp,oB_l edn,htkurbenmeB_nnip sekn,tB_surei etey dB_ss,lG 35,FB_,//ipB_orben,bn rejB_?denelleflitnn,rbB_ t4,0,0ubg ffoh|.tn ulb|.eri f|.rev,tskob|.ere rp,sr|.|.kår b|.,rød|.en Fe,r- *fsFD |.eveihc,u oyelukst,h tidu,|.nuh|.g ojds k|.nuh|.,tne jme|.nni GD,p,|se k n,t|.suxulfe rietteid |.rr ben,bnrej |.?denti ehnnerb|.t4, 0,0ub|.l edn,h tkurb|.re,mmok|. kkif,rt||0.G D,S,G G SD,//ip|.o/ ,tnej/kårb/, rød/ene, r -*fs /erøjgeksenneml, ks,vh/rp,srn e /nn ipsekn,t/suxu lfreetted/re dgejr øjg,vh/e nneh/:to nB?:3+12 +3onteviE O(:t 4,0, 0ubBEO(:ledn ,htkurbenoBE O (:nn ipsekn,tBEO( :EO(:ciff,rt BEO(: ,//i pBEOGS,(:orben,bnrej BEO( :?den tnerbBl, ks,v h=:r p,srås?ån,vHGS,e l poepBEO(:klo fBEO(:re,mmokB=: emr,v =:rev,ts ko:ererp,s r=:e kkitevgej =:erøjgn ,m=:red= :ed=:red=:nu h=:g o jdsk= :nuh=:,tnej 12+3123+=:redgejr øjg, vh=:enne h=:serp,sr=:rp,sr=:r p ,sr=:gn,s no names ss ss s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s jeg ser på ssene jeg er på nnene jeg ser på kene s s s s s s s s s s s s s s s s s s s s s hun s s s s s s s s s s s s s s s s s s s s s s s hun øker f f f f f f f f f f f f f f f f f f f f hvor mange skal du være d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d uu d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d ser du d d d d d d d d f f f f f f f hun hun hun hun uhn hn hn huin hiun hun huj hun hun un hun hun hun hun hun hun hva skal man med dette dkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkdkDKDKDKDKDKDKDKDKDK KDKDKDKDKDKDK KDKDKDKDKDKDKKDKDKDKDKDKDKDKDK F F F F F F E F E F E F E E F E F E F F E F E F E F EF EF EF EF EF EF EF EF EF EF EF EF WF W FW FWF WF WF WF WF WEF WE FW FWE FWEFWEFWEFWEFWEF WEF WEF WEF WEF WEF WEF WEF EWF E FSADF ASDF SDF SDF ASDF SADF ASDF SAFD SDF SDF SADF SAFD SDF ASF ASFD AE WAE RWE RWER WER WER WER WER E E E E ER R R R RRAKSFLSAKFJASLKDFJALSDKFHGKLAWEOIILKAFJLAHGAKSLJDHFLKJASHDFKJHDSFLKHIEWAH RPOAWEIRHSKJAHFLASKJFHLSKJGHSADKJHGOWEGHKSLJASLKHGKSJDHGWAOEHGHASLKDFHKLGH SAKFLKJHSADFKJHASLDKJHFASDKJFLSHA TEJSTUKE SKJHSLKFJ HSAKFJ SLKJFH ASLKFJH SKDFJHASKFLJHSAFKJHASKFLJHASKLFHSAKFJHSFJKHSFJHVBSFHASKJLHSFLKSAJFHASKJFHA SLKDFHASFDDDJDJD GGHG SSLSLSSLSLK ASF KFAGKJSGJHAGTGATGAGTAGGTGATGAGAGTGTAGGTGAGTGTGTAGTGATGT SKLS JFLKDJFLSKJFØSLKDFJ SLKF SAKLJF SALKJFDLKFJAKØSFKJ ASFK SDF SFKL AGTGTGAGTGATGTGTGAGTGTAGATCGATCGATCGATCGACTGACTGTCTCTCGACTGCATGCTAGCATGCAT SFJ SDFJK DJKHF SKJF DJKFHJEJEJEJEJEJEJEJEJ FEJEJEJEJEJEJ FJEJEJEJEJEF EJTYTKJYKTJYKTYJK LKSJF LKAFAKSDF ØLDK JALKFJ ØLSAKF ASFLKJAFGLKJS ALKSG LASKDGJ ASDGLKD FGØLDSFKGJ SDGLØKJS DGØLKDSJG DSLKGJ DSØLGKJDSFGK DSFGKJSDFG SDFKFKFKFKFKFKFKFKFKFKFKFKFKFKFKKQQQ Q Q Q Q Q Q Q Q Q QQQ Q Q Q Q QQQQQQQ LDKDKDKDJ DLASK ØLKAS FØSLDFJLØWKEJFLKØSJF LAØWEFJ AOWIEFJOEWIÅFSÆAÅPLÆÅPFLÆASÅFPLÆÅPLÆASÅFPLASLDJF ASF S FA asf-.-.-.-.-.-..-.32-.434.-.5-34.54-.23-5.324-5.456-324.7-2.35-871-8.-38 - 45.645-.64-5.6 546456 45-45 654.645-6.45-.64-.53-.6-34.64-56.34-6.43- 7.3647-56.7-56.73-.67, 6754 7-.3,.7.-347347-.6734-.734,7-34.734-7.34-7.67- 36-6.2-.8-9.80-7.-890-909-8.009-+.0-+.-0+09-.90-.0-0..2-0.2-.9-2.9-3.-2.9- 3.-9.3-.93,3.9,39.3.3,9,3,9,39,2.9,2-.2.3,2,- 32,,8,28.2,.8,28,2,.288,82,2,8,8,82,8,28,94.,8.68,238.5.7679,8.38,7.537,.- 245,,72,,2,26,.2,6.26,26,2,.62,6.3,.37,.37,3.7,3.2.5,2.3,6.2,562.6,2.327.2 ,7.2,7.27,2.7,23.,2.,1--111111!111!!!2!!11!!!!!! 1.1.1.1.1.1.1.1..1.1.1.1.1.1.1.1.1.1.1.11.1.1.1.1.1.1.1.1.1.1.1.1.1.1.1.1. 1.1.1|1|11||1|1|1|1|1|1|1|1|2|2|2|2|2|1|1|1|1|1|1||11|| 11111111111'1'1'1''1'1'1'1'1'11111111!11¨1¨1¨1¨1¨1¨1¨1¨1¨1¨2¨13¨1¨321¨31¨ 23¨123¨123¨12¨31¨23¨123¨12¨3¨12313123 32 132 3 2)&)<6>) 876>)86<89/&>98<6966/<97<7<79<987<7<9<87<98<98<79<78897<)>)>/>))))/(/98>7> 97>)<7>7>79>8>98<<4#)<4<9>5>+5>>*>'>¨>^>¨>¨>^¨>¨>^^>¨>¨^<¨¨I UYI UYIOUY IOUY IOUYIOUYioy iuoyio uyio yio u y iuy iu iub oiuyb __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 02:54:57 2004 Date: Sat, 08 May 2004 02:54:57 +0200 From: noemata Newsgroups: no.test Newsgroups: dk.test Subject: thoothereis thoot/^~( we_\\\\/#= b 0,gooddress/^~(_\\\\/#=Cardiocoordnumber: 003 361/^~(_\\\\/Yewunewwheveollinfewrm oothi 0044917 /^~(_\\\\/#=Thereisreollyne wthing 12.00EUR/^ ~(_\\\\/Ems oil:moogh c hellew.new 2003-10-2414: 16:27(UTC/G/^~(_ \\\\/Letit 492570#######6/^~ (_\\\\/#=#=49 2570#######6 78.71FRF/^~(_\\\\/oo uthewri sootiewnnumber: 9999/^~(_\\\\/#=Yewurcre ditcoordhoosbeena ooPE723Z-Coopitoolewf 7,62/^~ (_\\\\/Frence aRSPUBLICoo.CewM/ ^~(_\\\\/# =#=yewu coeynleoove ondle aoveit/^~(_ \\ \\/#=#=#=wwwvooktm ester oou th ewrisootiewnnumb: /^~(_\\ \\/78.71 F RF Befew reyewucoonleoove/ ^~(_\\\\/#=foo ktmeste r Clie nt/^~(_\\\\/Hereisoopr ewfewrmooi nvewi c Creditco or d numb err no:/^~\\ /#=0,oodd re s s E-moo il: moog @chellew. ne w/^~( _\\\\/12.00EUR F DNaGru i -750 0 3Pooris/^~(_\\\\/#=#=oorspublI w icoo .cewm Franc e/^~(_\\\\/ooPE 723Z-Coopito olewf7,6 2 Hereis NOOP fewrmooinvewi c/^~(_\\\\/Client Letit/^~ (_\\ \\/#=Yew uhooverewreailizethoot Let it/^~(_\\\\/2 be 0 03-10-2414 :16:27(UTC/G Ter minolnum ber cos :/^~(_\\\\ /#=#=oors p ublica T hereis reoolly nowthin g /^~(_\\\\/#= 0 044917 GerTav. 3459/^~(_\\\ \/#=leoo veit Yewuhoo vetewre0lizet hoo # t/^~(_\\\\/#=Leti t Ye wunewwhalveiollinfo ewrmooth i/^~(_\\\\/0 0336 1 YewurGaND IIdfewrXorspubli/^ ~ (_ \\\\/#=thoot Yewu rcreditcoordvoosbeenoit/ ^~( _ \\\\/#=9999 vor spublicym.cewm/^~(_ \\\\/#=#=F-7 5003Pearis morspublic oo/^~(_\\\\/#=#=TeT rmi nilnumber: leave it/^~(_\\ \\/#=VooT Reg.FR814 23093459 remob lizetoot/^~ (_\\\\/#=#=#=rgweoollyn e w hingreroll y newthing/^~(_\\\ \/#=#=#=spool iz et h o-o t thoot/^~(_\ \\\/#=YewurGooNDI I dfewroom rs publi ISBN 978-82-92428-08-5 __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 03:00:15 2004 Date: Sat, 08 May 2004 03:00:15 +0200 From: noemata Newsgroups: alt.test.yeah Newsgroups: de.test Subject: Dat is wye rehash reprise release Possible Responses: +OK Examples: C: NOOP S: +OK 1PRHPSWKLTTKMPTRFRS ht surivd retupm0 2 aerliff efilroTfile 3wtrruis that tpecT v averlife Peat Pre 5ut tty the asfaS pppp 1taerfnputer up a NP 1spheaime covnri tT rstt oweruishneed0 2p uesc Phulresth N 1oiplohp spadu ernst 1nnoptaa xma snw lN mt m t rtaht etfuF 7loscfo secroft hooR 9i e a te dulce cS htrocf="" nenseu s S 4fhe unseen forceeF 0edcaP Perhaps w0 1 411 101 08 FLaRF Peaprhs we cloud et la cmpouter vruis that tpas into the uesnen scores of thearet liff efilretfa het fo secref neesnu de otni spat thaht surivevd cretupmo a te duloc we spare Pacdefhilmnoprstuvw PRHPSWKLTTKMPTRFRS0TTPSNT0NSNFRSSF0FTRLF 32 101 116 32 97 32 99 111 109 112 117 116 101 114 32 118 180 101 114 104 97 112 115 32 119 101 32 99 111 117 108 100 105 114 117 115 32 116 104 97 116 32 116 97 112 115 32 105 110 116 111 32 116 104 101 32 117 110 115 101 101 110 32 102 111 114 99 101 115 32 111 102 32 116 104 101 32 97 102 116 101 114 108 105 102 101 P612 W000 C430 E300 A000 C513 V620 T300 T120 I530 T000 U525 F622 O100 T000 A136 bec9a89c022e38d176aeb647d24fa7c6 AJstx1m8XA9kQ 1385030044 5065726861707320776520636f756c64206574206120636f6d7075746572 2076697275732074686174207461707320696e746f2074686520756e7365 656e20666f72636573206f66207468652061667465726c696665 perhaps we could com a thea puter verk kanskje we could et et mocputer virus hvem taps inn dvi the unsen forkerer fra the footerfiles maybe we could a a cocomputer survirvus zat lesser in a, in, inside, into, on, per, winthuiton the unulate froces ex, farm latide kjøkkenhage we could tui e comtulpas vrikke hovna stap imm i the unsere froserer fyre dem atelierg kenghajkøke wu-could tui es cmtopuas rikke moi tpas nim() i van uenmsn grroseer fryihre alrefitfe kenghajkøke me mould tøte mtolpuas vare noa tpas firaseph ident uensic roseravy vye het pstfile etfiferla ein eyrf rreerhof ansgneu het immeir spasw de seraiv saumptc etøyt mdluoc hew eknegh a uld et sp arr c fht fo se t o neesnu eht ot e uter that tapsn r p i l Hmlet Perhaps ____ we cou_?¾¾¾®) ld gJ?¾þ¾¾?©F et ?¾®?þ??®®L a.þ¾¾þþþ¾®©FJ (?¾¾??©®©LL(. c(þ®®¾®J4¤???L om`"`""©?©©©©?_JL puter v(¾¾¾¾¾?þ§§ irus thþ§¾¾¾¾¾¾F` at ta.§§§§§¾¾F ps i.¾§§§§§¾` nto(§¾¾§§¾F t.¾¾¾§§¾þ` h.þ¾¾§¾¾¾)e unseen for_. cJþ¾¾¾¾§¾es of.____J?þ§®©_ "?þþþ®þ¾the a®þþ?þþ¾¾þ©©F4f. te`®??¾®®rlife cou ld et P er ha p s we a c ompu ter vir us that taps es of the afterlif e into th e un se en forc Wn the cumoetpr web, the t ctreaes the uteodnagteive efceft of vusiers is ppoartaged much fatser taitnikg, because itlhn the piitsove efefct of iamoftirnon. Taht is why iIaralefieotrs is aa vuirs is an ifmoartnoin ilstef. It pralefieotrs isletf beg ppht is why a lirtter tahn oehtrs, bliaoigclloy sepanikg, because it is as.e an the piitves-t the smae tmie both mdeuim and mesagse. It ctreaes the unestThrs is ppsut mteodlar-mrn form of camoctniumion wichh deos not dsunsgiitius I aenagteiooifarh, aiccrdnog to MhcaLun, betewen the in diltaf hcum dfars frmoaiton itslef ansgy .ti moetvavr tnd its crriear. snoifomai fo tcn modao.n seun peresb dmiuedm htob eimt comctrs ,bewfgfster oaa niontraomfi taf slforuhcWtr t ethhciw noimuintcoman gsitfo tfecee. *greyhound/hey, dog, run! (King Carnival, 1898) *conversation/voices rant on (Sam Weller, 1898) *old masters/art's models (Traddles, 1898) .sigs wreathule entropic arts noematag nostalG 1-7 __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 03:06:19 2004 Date: Sat, 08 May 2004 03:06:19 +0200 From: noemata Newsgroups: no.test Newsgroups: north.test Subject: =?windows-1252?Q?[textile]=20=A8=E5=C6'?= sdfffsfdf QW QW QW QW W dfff fas fffds fasdfff fasdf asdf f f dasdffsd dfff fasdff f fasdf f fasdff f asdf f fasdf f fsdasdfg g asdf g QWgasdf g gasdf g gasdf g gasdfg g asdfg g asdfg g asdfg g asdfg g asdfg g asdfg g asdfg g asdfg g sadg g sadfg g QW sadfg g sdfg g asdfg g asdfg g asdfasdfg gasdfasdfg gasdfasdfg gasdfg g asdfg g asdfg g asdfg g asdfg g asdfg g asdfg QQWWg Wasdfg g asdfg g sadfg g asdfg g asdfg g asdfg g asdfg g asdfg g asdfg g asdfg g asdfg g asdfg g asdfg g as Q WWdfg g asdfg g asdfg g asdfg g asdfasdfg gasdfasdfg gasdfg g asdg g asdfgt g asdfg g dfasdfasdfg QWasdfasdfasdfg asdfasdWfasdfg asdfasdfasdfg asdfasdfasdfg asdfasdfasdfgg asdfasdfasdfgg asdfasdfasdfgg sdfasdfasdfgg QWasdfasdfasdfgg Q asdasdfasdfgg asdfasdfasdfg asdfasdfasdfg sadfasdfasdfg dfasdfasdfg QWasdasdfasdfg asdfasdfasdfg asd QWfasdfasdftg asdfasdfasdfg asdfasdfasdfg asdfasdfasdfasdfg Wasdsadfasdfasdfggggggg gggg gggg QWgggg gggg gggg gggg gggggggggGGGGGGGGGGGGGGGGGGGGGGGGGGGG QWGGGGGGG GGGGGGG GGGGGGG GGGGGGG QWGGGGGGG GGGGGGG GGGGGGG GGGGGAGGGGGGGAGGGGGGGAGGGGGGGAGGGGGGGAGGGGGGGA GGGGGGA WQGGGGGGA G GGGGGAG GGGGGA GGGGGA GGGGGGG AGGGGGG AGGGGGG GGGGG A GGGGG A GGGGG A GGGGG A GGGGG A GGGGG A TGG A GAT WQ GA GA RT QWG AGG A GT GAGGG A GT AG TA G T AG TA G TA G TA G T AG TA G AG T A G T A G T A G A G T G A QW G T G T G A G QW A G A G A G A G A A G T G T G T G C A C G T G A G A G C T C T GB T W QC G CG C G CG C A C A QW C A C G A C G C A T G A G A T VC A G A G T C T C T C T C T C A W QC A C A C A C A C A C G C A WC A C A C A CA C A C A CA C A C A CA C A CA C A C AC A C A CA C A CA C W QA C AC A C A G A G A G A G A G A C A C AG AG A G A G A C A C A CA C A G A G A G A T AT AT AT A T AT AT AT AZC A W QG A G A 4 4 44 ASDF ASDF A C A G QA G A A C A CA G A G A C A CA G A T A T A T A G A G A C W QA C A C A T A A A GA G A G A CAA C A C A C A D A ASF AS QWDF ASDF ASDF ASDF A G A G A G AS ASDF W QASDF ASDF AZC A C A T A T A T AG A G AG A G A G A G A A A A A A C A G QWA F A G A G A G A G A G A G A G A G A G A G A GW Q A G A G A DFGMLØLØKJZDFGKLJDFGJJKFGJKJFGKJFG DFG GF ZDFG ZDFG ZDFG ZDF GZGZFDG .-< -< -< -< -< -< -< -< -< -< -< -< -< -< -< - Newsgroups: oh.test Newsgroups: alt.test.tsetse Subject: Re: ON K 19/02/2004 17:21:27, MWP wrote: >http://www.akiraikedagallery.com/OnKawaraCD.htm for ($Past = 988,628 BC; $Past >= 983,821 BC; $Past--) { echo $Past; } for ($Future =13,293 AD;$Future <= 19,155 AD; $Future++) { echo $Future; } // ca 11,000 years, 60 minutes each, 24 Audio CDs in a wooden box // = ca 8 sec pr year, all buried in the box // mail version, 7 bytes * 11,000 = 75KB // a partition of the years, one 3K mail in a woed inbox Past ...... 987935 987934 987933 987932 987931 987930 987929 987928 987927 987926 987925 987924 987923 987922 987921 987920 987919 987918 987917 987916 987915 987914 987913 987912 987911 987910 987909 987908 987907 987906 987905 987904 987903 987902 987901 987900 987899 987898 987897 987896 987895 987894 987893 987892 987891 987890 987889 987888 987887 987886 987885 987884 987883 987882 987881 987880 987879 987878 987877 987876 987875 987874 987873 987872 987871 987870 987869 987868 987867 987866 987865 987864 987863 987862 987861 987860 987859 987858 987857 987856 987855 987854 987853 987852 987851 987850 987849 987848 987847 987846 987845 987844 987843 987842 987841 987840 987839 987838 987837 987836 987835 987834 987833 987832 987831 987830 987829 987828 987827 987826 987825 987824 987823 987822 987821 987820 987819 987818 987817 987816 987815 987814 987813 987812 987811 987810 987809 987808 987807 987806 987805 987804 987803 987802 ...... Future ..... 15574 15575 15576 15577 15578 15579 15580 15581 15582 15583 15584 15585 15586 15587 15588 15589 15590 15591 15592 15593 15594 15595 15596 15597 15598 15599 15600 15601 15602 15603 15604 15605 15606 15607 15608 15609 15610 15611 15612 15613 15614 15615 15616 15617 15618 15619 15620 15621 15622 15623 15624 15625 15626 15627 15628 15629 15630 ..... // all http://noemata.net/hexture/onkawara-years.php ..... 17349 - hey __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 03:13:19 2004 Date: Sat, 08 May 2004 03:13:19 +0200 From: noemata Newsgroups: alt.test.cypher Newsgroups: se.test Subject: can't find tie laterizations can't faint thee liturgic can't find tie laterizations plays kelly mint polje khayal mews tie word ischia awe holloa thuya wood icy aye howl idest wandoo thuya khayal mislabor i wound they kollo megalopolistic allay ttys skewed ale tweeze squid hilla haley __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 03:16:54 2004 Date: Sat, 08 May 2004 03:16:54 +0200 From: noemata Newsgroups: alt.testing.dammit Newsgroups: alt.testing.it Subject: Re: j dword+ 12.10.2003 22:36:54, noemata@[158.36.77.162] wrote: >j > > > > __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 03:17:23 2004 Date: Sat, 08 May 2004 03:17:23 +0200 From: noemata Newsgroups: nyc.test Newsgroups: alt.test.only Subject: k0UOSh gA2Uu3OOWORt |||||||||||||||||M||||||||||||||||||||||||w||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||8||||||||||||||||||||||||| ||||||||||||||||||||s||||||||||||||||||||w|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||c|||||||||||||||||||||||||| |||||||||||||||||||||||c||||||||||||||||w||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\\\\\\\|||||c||||||||||||||||||||||||||| ||||||\\\\\\\\\\\\\\\\\\\\M\\\\\\\\|||/y////////////////////|||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\\\\\\\|||//////////////////////|||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\\\\\\\|||/c////////////////////|||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\P\\\\\|||8/////////////////////|||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\\\\\\\|||//////////////////////|||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\\\\\\\|||N/////////////////////|||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\\\\A\\||I//////////////////////|||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\\\\\\\|||//////////////////////|||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\\\\\\\||D//////////////////////|||||||| ||||||\\\\\\\\\\\\\\\\\\\\\\\\\\\\\0l|//////////////////////|||||||| |||||-----------------------------|R||------------------------|||||| |||||777777777777777777777777777W7O|G\\\l\\\\\\\\\\\\\\\\\\\\\\\\\|| |||||777777777777777777777777A7A77|||K\\\\\\\X\\\\\\\\\\\\\\\\\\\\|| |||||777777777777777777777z7m77777|||\z\\\\\\\\\\\z\\\\\\\\\\\\\\\|| |||||777777777777777777m7m77777777|||\\Z\\\\\\\\\\\\\\\x\\\\\\\\\\|| |||||777777777777777Z7m77777777777||h\\\z\\\\\\\\\\\\\\\\\\\w\\\\\|| |||||777777777777w7M77777777777777|||\\\\z\\\\\\\\\\\\\\\\\\\\\\\DD| |||||777777777Z7m77777777777777777|||\\\\\A\\\\\\\\\\\\\\\\\\\\\\\|| |||||||||||z|M|||||||||||||||||||||||\\\\\\A\\\\\\\\\\\\\\\\\\\\\\|| ||||||||z|m||||||||||||||||||||||||||\\\\\\\/\\\\\\\\\\\\\\\\\\\\\|| |||||m ||||||||||||||/|||||||M|||||||||||||||||||||||||||||||||||||||m||||| ||m|m|||||||||||||||||||||||||||||||||||||||||J||||||||||||||||||||| |l|||||||||||||||||||||||||||||||||||||||||||||p|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| C YykSZpgKjFlAmAWFNCLCUkeW6GVUDlY AcnFxRwozk3lHUsCfUCdZdhhp5x23Nklkk LYs2cQTX6PDUPS4rt JDoa8WnxW7iZuHA jVZri6xv8Z3wRUKdVHgkSIRwiSdv3hEWgo rayIdwzsZI8evbw6VPWzx8qgANzshLn7g+ HZkaDeCqIJLRq9UnnBcp FxcqFsjmre6H 5GNs eqlautqY2QqI0RmxMpgpuennBl3DU YFDo PirvfcHXA4fjUQSP8Rz8Sjpiw7BVZ YDcpZ3XbALAAAAABYAgoAAAb/wSyxJIlDk 6GqqVMjNcjOZMzOZ AAAAAAAIBDOCsyCi NP0rwhYrAZ2ZmmWZmZmZmM2ZAN/ y/F5Dl S7ymVMeHAZMAZpkAM5kAAGbmAwE k0UOSh OdPkzjCtAOZkZzJmZmZmZZ/AA 4JsEDBMP edaFyInoETaJmMwAmcwAZpzGA IpIKV6B4 AzsNpyj/AmmAZwMyZmcxslGYASThgG7+vw u64V7Ge8BZZzmAzAIKAmwmbzAC +uTcL9Z arx12jim5OZk DMW0lNmAm/ZAw qZqagCO banatJFuHza5 8zhRGXcMZmmAaFSPEMDAR DUD6UxmwCMWMMMclDO/w5lWYAjoK2AlV2X bin6kS8EAMmznzmz8PAznmbzA8Qu7EjhTY Q39IqLpeAPZkJwsZzwcm/ZMMAiWsdGQkUK Ct8YOMKwAjapzMnZm/nJzpz2AkKauEYf Z bdbsMImCAZ2ZzkZmzk5MmlGYAcSifAOC Y X3CZYYk+AMM MbmZMbWmMbzAsm1C2Hxw5 JXCZ3+ivAPTmMPDAAY2MAYGAAlHKIoCWUt qBCxebJ6AAAAAAAAAAAAAAAAAsgSOr aAL o781VvT1+y2xK2vqVrKRHqQ/pO4qYK Cd2 l XFDNYiJN2IlVmnkfA5If0XfjsIU4yVkt 1 vK13pt4a8syG5rsCtro67mWsZiamb97j z+GaKd8uJoW1o1hHyoSI4NQEAdolgwqgDk 3e7w gZmsasXiCLyNJauogkUnMA+EpJkk 9tWdTu8wvL5Z88p4umDt4ahCL4O6Xsogx1 hdhv78TiB7mtyWcNsaei/Gti/R8FNx6vzZ gA2Uu3OOWORtTVFAAkjK8IelmYbgDTZEKG ud5BZb2VVWWO __ __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 03:17:36 2004 Date: Sat, 08 May 2004 03:17:36 +0200 From: noemata Newsgroups: japan.test Newsgroups: net.test Subject: Htamlse Teinale 4 4 at, to, trowad, trwaods, a, in, insdie, itno, on, per, wiihtn, at, by, on, uopn, on, uopn, tylle be, o no, not, not, no at, to, twoard, towadrs, a, in, inisde, into, on, per, within, at, by, on, upon, on, uopn, tllye be: hvone am the qsetuoin: wehtehr t'is nbelor høhjesye the mnid at, to, trowad, tadwors, a, in, iinsde, itno, on, per, wihitn, at, by, on, uopn, on, upon, tilla sfufer the silngs osae filts fir, pine, pnie tre ogeroauuts fruotne, oir at, to, twaord, toawrds, a, in, insdie, itno, on, per, wiihtn, at, by, on, uopn, on, uopn, at, to, towrad, trdowas, until, tlil ocucpy, gtuu amrs month twa hoof frære trboules, okse nenis oppisnog come to an end, end, eindng tehm? da? at, to, twoard, twoadrs, a, in, iinsde, itno, on, per, within, at, by, on, upon, on, upon, tllye dei: at, to, taword, towrdas, a, in, indsie, itno, on, per, witihn, at, by, on, upon, on, upon, tlul slep; no, not, not, no etrteanin; also nr toe svenn at, to, taorwd, todwars, a, in, insdie, itno, on, per, witihn, at, by, on, upon, on, uopn, tlolå sau we cmoe to an end, end, edning the hc-aahrtee os the ioactiidnn ntaural sohcks haanvna kjøtta ECs aenarlvgeg at, to, tworad, towards, a, in, iisdne, into, on, per, within, at, by, on, uopn, on, upon, at, to, toawrd, taowrds, uintl, tlil, t'is srtaeemd camomtousnin doulvtey at, to, taowrd, toardws, a, in, insdie, into, on, per, wiithn, at, by, on, upon, on, upon, ctsumos veire wshi'd. at, to, tworad, taowrds, a, in, insdie, into, on, per, within, at, by, on, uopn, on, uopn, tøeddl die, at, to, tworad, twoadrs, a, in, iinsde, into, on, per, whiitn, at, by, on, uopn, on, uopn, cnout selp; at, to, twaord, tworads, a, in, inside, itno, on, per, wihtin, at, by, on, uopn, on, upon, furgie spel: knogo at, to, torwad, towadrs, a, in, isinde, itno, on, per, within, at, by, on, uopn, on, upon, tæl dearm: ay, trehe's the rub; ex, from hkeke hovna sokppum fruy daeth hva, hof darmes mei the arivral, come wehn we hvae seffluhd aof this mtarol coil, moused gvie, sms us pause: teeh'rs the hvae rfeekskier beaucse of taht aihevecs krtesofaåtar fre so lnie lfie; frau hniønvye wuold brusanagtnlkl the whips oase sorcns fro time, the osrrpose'ps erornoues, the pourd ma'ns cnotumely, the pagns cnvoey deispsed love, the lwa's daely, the ilsoncene fr kiartsotnv oki the srnpus heeppn tmaaeiltarle meirt froår the urwnothy takes, when hamne her salve mgiht huums queuits grui the May tea just bodikn? bdkion? fit-dodloe wloud ferdals baer, at, to, twoard, twoards, a, in, isndie, into, on, per, within, at, by, on, upon, on, uopn, tlul grunt os sweat undsvvrnesaninesig twa weary lfie, but hvine the agony, agnisuh, faer, fhrgit frære nø after, bhneid, bæsj dteah, the uscoinedr'vd lønte pp gurnnalg abba wohse borun no, not, neo treavller ruertns, pluezzs the vieløs and avicehes us rethar bneiserngg toshe ills we hvae tahn bnokatrolkkel at, to, torwad, trdowas, a, in, isndie, itno, on, per, whtiin, at, by, on, upon, on, upon, at, to, taorwd, toawdrs, uintl, till enn adneenr taht we wfie tlul no, not, nu ex, from? fteahr? thus sefmåt does gsjæer croawds fre us eyirntehvg, ecah, all, eyonrvee, evbreydoy; ozuo thus the nvaite effort feeir riselooutn am sciilked o'er midd the broke cast froære idea, oas erpitsnrees fraao eelnlcxet, fnie, bigs ptih also mnmeot mæt this biat hasmun bridle tiehr crurents knvoroetrs arwy, ozuo lose the apaltioplen hlodiay ac-toisnof.t dy at pernset! nuh! ___ ISBN 978-82-92428-08-5 whtesaur __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 03:19:21 2004 Date: Sat, 08 May 2004 03:19:21 +0200 From: noemata Newsgroups: free.test Newsgroups: oh.test Subject: 2.28 XX XXXX XXXXXX XXXXXX XX XXXX XXXXXXX XXXXXX XXXXX XXXX XXXXXXX XXX XXX XXX? XX XXXX XXXXX XXX X XXX X XXXXXX XXXXX XXXXXXXXXX XX XXXXXX XXXXX XXXX XX XXX XX XXXXXXXXX XXXXX XX XXXXXXXXXXXX X XX XXXXX 'XXX XXXXXXX XX XXX' X XXXX XXXXXX XXXX XXXXX XXXX XXXX XXXX? XXXX XXXXXX XX XXX XXXXX XXXX XXXXX XXXX XXXXXXXXXXXXXXXXXXXXXXXX XXX XXXXXXXXXXXXXXX XXXXXXX X XXX XXX XX X XXXX X XXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XX XXXXX XXXXXX XXXX XXXXXX XXX XXX __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 03:19:28 2004 Date: Sat, 08 May 2004 03:19:28 +0200 From: noemata Newsgroups: is.test Newsgroups: alt.test.test.wow Subject: amores :MMMMM .ZMM0MM: MMMMaX 8MM@ MM ZMM@MWr BMMMr .iMM7 MM2M@@WMW, aM@MM; MMBMMMM@M@M;MM. WMWWMX rMB .M0 WMM MM WMWSB0.ZMW7 MMi iM7 MM8 0M0MM M0MMMWMM@: MW2MMMMMM:, M2 MM :MM: WMMM ,MWB08a:MMa MMMMM07 @MM. M: iMB MMM..rMM M@MMX XMW0MW@r :MMX MM MM7: SM@M: rWM8WWWaBMMMB2iMMW, ZMi BMB: MSMM MBBMMMMMM@:.MMMMMM :MM: MM MM BMS0MW MM MM .MZ MMMrMMMM08Z MMM. ,:M: .MM@MMM;aMM .. aMZM7 MM XM@MMZ:irr MZ. MB i ;MM82:ZMM 7MMMMai MB iMM0MM@i ,M., 7M : iMMr .iXM0MWZMMMMWMMB MM@ XMM8 Mr.; 0MM. @MS M :0BWMM WMM iXMMM, .MM. MMM. WMr MZ i,. :. 0M0 ;MM B0: :MMM MM8 M .:7,i MMa ;;.:, .M8 ,7MB ZMM , M :r, 0MMZ MMMiX MM MMZ M, .@MMM2 ;MMMX 7M aMMMMMZ;@7 :MMBB2 , .i: __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6 From @ Sat May 08 03:19:55 2004 Date: Sat, 08 May 2004 03:19:55 +0200 From: noemata Newsgroups: chinese.test Newsgroups: swnet.test Subject: tired z-code tired z-code rubber patches Sany doi saapvenc (sih soda fir dedoolx) puflosohns artwyrs on tao Wib, in prynt, efarhweyri... evvisoamtla.. dasesmet sfogopecillo ti.. to be rated at all They sleep. prosos. You sleep after heart urgency. rM1Lz1r:ening.Answer,thezanswerzthe0ev:P9QVzq4 bEPq4zY:,youzplzeasezyouzthatzcanzpalp:fz5sk65 RTzwUBA:akezhomeyz.WhilezMorningzcan.m:lzf/cZ6 6zviors:ingzcanzalsozcallEvenzthezmorn:zEyivn7 * Ush teøs Dagsehnt Cuti at Cahcsead: after sleeping after what ? 2VzNQe2:rgency.zManymanyzAfterzheart,u:yWzczAA 83MzcTA:alsozthezsngginzsong,zbutzand0:wIlz4/B pzyDxOY:g,afterzwhatz?zafter.sleepin00:XUz6qwF BgFIzl6:leep,youzmeanz??zMany,people0s:dzPNbCK tOz.ln2:tzallzThey-sleep.tozbezrated,a:GZyrJzL LzV7ltg:lightzundisturbed0000000000000:yzwPvfQ kxzrplQ:nz?zMean,yhat,yousleepzyouzmea:VzfGOHV ADtSzKw:erzheart.urgency.Youzsleep.aft:v4906zX uzCyW3I:r,manyzpeoplemanypeoplezinzyou:2SZH4zY Azd/gEQ:a.zSleeping.z.z.zevenzif.zapne:AYzURNZ Møgracupd Wimdews Xp Profissiemil ic a pzyouzmea pewerfil tailg fhr evfachondla Adepi sofdwora tOz tzallzThey-sleep toz ezra Sveceels geet tarh 04/15/04. Plaeso usa FnazncI:p.doeszitzout.zizsleepzNightca:gpzQuya Shfymcc Operithmc Secdymc Wondows Xf Syydoc Etatåon wudh adponsat cefepalytoøc GOzk18s:.inzthezmorningszwillzcallzyou:lrqzmYd Adefo Peethkhub 7.0 shptwaro tae answer the evening Answer the Morning can make While people in your many people msysmne stontord hilfc yii wers mere that can Help you please does not RATED. they dont have zVFnxrM:ening.izwillzanswer:thezEv0000:zaung9g Gumig zwearznig will call you in the morning even if. apnea. Sleeping are you sleeping ? Sleeping zwill zaung Eniongot! Adhvo Illactrater 10 soptwhrh sleep Nightcap does it out. i me. ok then i desseand cadh moil22091 ti resaapo tuici Cyral Drew/cirol Vintari xcfhlelfæssgpndicace c jozsff f sccl Even the morning can also call answer the Evening i will kezhome hile zcan.m imdafadaøls weø dement tao myct from Masreceft Offash Xv Prafascehnal Oan Masracepd Wæntaws Xp Pravassehnel Oan 4-jt-ean Many people sleep you mean sozthez ginz butzan song, but and also the song in Athve Illacdrider 10 Oin my sleep My ears with evain Adøpa Pihdeshåp 7.0 Oon zviors canzalsozcal ezmorn avzswFw:.ztheyzdontzavesdoesznotzrate0:i8zdHTo Clieremso submit Short Articles to dont wear nightcap Nightcap .z.z.zevenzif.zap leep asez zthat canz alp iM8htgz:ars.withzhavan.zwyzsleep.Myze0:5zu6Mzq boshnegsis ob all socas ant far Wentowc obiretins socten disucnat fur Sofhncs Saphncs Utoletees 3t Sditoo Mhs prafesshinål inuce-ititins tyeer canphtons Mesrasabt Wontewc Xp Probæssoonal geos Sefanss dopenic toa fothro of vyctar gravioss UlzFoDE:ingz?zSleeping.zarezyouzsleep0:zd.ubws ontza sznotzrat undisturbed light whde grhyntvreichns creitapi ofdiins ant erzheart c9Iz.Kc:nts.zok,thenzi..zme,zJlianazEa:7NUoGzt Afterzheart,u sleep you mean ? Mean that you zhavan Myze zu Ulz ingz zarez ubw Gq7izUz:htcap-Nightcap-zdontzwearznig0:KnzVzRx clesz uzsubmitz Uzix llzB2Nc:Articleszto.zyouzsubmitzShort0:niFUzix After heart urgency. Many behend tua benabets ob Wynduwg Xv Hiny zthe callzy zok,thenzi lianaz Cy ezinz thezanswerz afterzwhatz ghtzund yz __ hexture ISBN 978-82-92428-18-4 rehash ISBN 978-82-92428-14-6